\
| Variant ID: vg0202909303 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 2909303 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 286. )
CCAGCTACTCTAAATCCATCCCTCAGTCAGTGCACTCCACCTAGTGCCATTCAACCACAAGCCATCATTGTTTGAACCCCTCCAATGAATGGTTTACCCC[A/G]
TCATGAACTAGGTTTGCAACACAATAACAGTTATGGTTCTGAAAATAGTGGTAACTTTTTTGGGGGAAAAAAAGAAAAGTATTATGAAAGACATGAGCGT
ACGCTCATGTCTTTCATAATACTTTTCTTTTTTTCCCCCAAAAAAGTTACCACTATTTTCAGAACCATAACTGTTATTGTGTTGCAAACCTAGTTCATGA[T/C]
GGGGTAAACCATTCATTGGAGGGGTTCAAACAATGATGGCTTGTGGTTGAATGGCACTAGGTGGAGTGCACTGACTGAGGGATGGATTTAGAGTAGCTGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.90% | 20.00% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 97.20% | 2.70% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 58.40% | 41.40% | 0.20% | 0.00% | NA |
| Aus | 269 | 17.10% | 82.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.00% | 2.70% | 0.34% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 43.30% | 56.50% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 88.30% | 11.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 44.00% | 55.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 21.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0202909303 | A -> G | LOC_Os02g05880.1 | intron_variant ; MODIFIER | silent_mutation | Average:50.56; most accessible tissue: Callus, score: 81.91 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0202909303 | NA | 1.14E-07 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202909303 | NA | 9.75E-12 | mr1157 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202909303 | NA | 2.97E-08 | mr1328 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202909303 | NA | 6.53E-13 | mr1446 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202909303 | NA | 3.33E-14 | mr1540 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202909303 | NA | 2.45E-14 | mr1732 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202909303 | NA | 6.82E-11 | mr1989 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |