\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0202891012:

Variant ID: vg0202891012 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 2891012
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTCTATCGGCGCGCGGCTGACGGAGTCCTCCTGAAGTGCATTCCTCGGGAACAAGGCGTCGAGCTTCTCGCCGATGTCCATGAAGGCGAGTGCGGAGCC[T/C]
ACTCCGCCTCACGCACCTTGGTTGGCAAGGCCTTTCGTCAGGGTTTCTATTGGCTGACGGCTCTTAACGACGCGGTCGACCTGGTCCGGCGGTGCAGGGC

Reverse complement sequence

GCCCTGCACCGCCGGACCAGGTCGACCGCGTCGTTAAGAGCCGTCAGCCAATAGAAACCCTGACGAAAGGCCTTGCCAACCAAGGTGCGTGAGGCGGAGT[A/G]
GGCTCCGCACTCGCCTTCATGGACATCGGCGAGAAGCTCGACGCCTTGTTCCCGAGGAATGCACTTCAGGAGGACTCCGTCAGCCGCGCGCCGATAGAGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.20% 11.10% 1.12% 39.57% NA
All Indica  2759 52.40% 0.40% 1.38% 45.81% NA
All Japonica  1512 48.10% 32.80% 0.20% 18.92% NA
Aus  269 17.50% 0.70% 2.60% 79.18% NA
Indica I  595 69.70% 0.20% 0.34% 29.75% NA
Indica II  465 65.40% 0.90% 0.86% 32.90% NA
Indica III  913 34.20% 0.50% 2.08% 63.20% NA
Indica Intermediate  786 52.80% 0.10% 1.65% 45.42% NA
Temperate Japonica  767 66.90% 7.40% 0.13% 25.55% NA
Tropical Japonica  504 13.50% 77.60% 0.40% 8.53% NA
Japonica Intermediate  241 60.60% 19.90% 0.00% 19.50% NA
VI/Aromatic  96 9.40% 0.00% 3.12% 87.50% NA
Intermediate  90 54.40% 17.80% 2.22% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0202891012 T -> DEL LOC_Os02g05850.1 N frameshift_variant Average:34.389; most accessible tissue: Zhenshan97 flag leaf, score: 76.925 N N N N
vg0202891012 T -> C LOC_Os02g05850.1 missense_variant ; p.Tyr1004His; MODERATE nonsynonymous_codon ; Y1004H Average:34.389; most accessible tissue: Zhenshan97 flag leaf, score: 76.925 benign -0.724 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0202891012 NA 6.83E-06 mr1029 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202891012 NA 2.61E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202891012 NA 2.63E-06 mr1425 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202891012 NA 1.70E-12 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202891012 NA 4.24E-07 mr1530 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202891012 NA 1.61E-09 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202891012 NA 1.48E-18 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202891012 NA 7.92E-06 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202891012 NA 7.93E-07 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202891012 NA 1.85E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202891012 NA 1.91E-08 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251