\
| Variant ID: vg0202891012 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 2891012 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CCTCTATCGGCGCGCGGCTGACGGAGTCCTCCTGAAGTGCATTCCTCGGGAACAAGGCGTCGAGCTTCTCGCCGATGTCCATGAAGGCGAGTGCGGAGCC[T/C]
ACTCCGCCTCACGCACCTTGGTTGGCAAGGCCTTTCGTCAGGGTTTCTATTGGCTGACGGCTCTTAACGACGCGGTCGACCTGGTCCGGCGGTGCAGGGC
GCCCTGCACCGCCGGACCAGGTCGACCGCGTCGTTAAGAGCCGTCAGCCAATAGAAACCCTGACGAAAGGCCTTGCCAACCAAGGTGCGTGAGGCGGAGT[A/G]
GGCTCCGCACTCGCCTTCATGGACATCGGCGAGAAGCTCGACGCCTTGTTCCCGAGGAATGCACTTCAGGAGGACTCCGTCAGCCGCGCGCCGATAGAGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.20% | 11.10% | 1.12% | 39.57% | NA |
| All Indica | 2759 | 52.40% | 0.40% | 1.38% | 45.81% | NA |
| All Japonica | 1512 | 48.10% | 32.80% | 0.20% | 18.92% | NA |
| Aus | 269 | 17.50% | 0.70% | 2.60% | 79.18% | NA |
| Indica I | 595 | 69.70% | 0.20% | 0.34% | 29.75% | NA |
| Indica II | 465 | 65.40% | 0.90% | 0.86% | 32.90% | NA |
| Indica III | 913 | 34.20% | 0.50% | 2.08% | 63.20% | NA |
| Indica Intermediate | 786 | 52.80% | 0.10% | 1.65% | 45.42% | NA |
| Temperate Japonica | 767 | 66.90% | 7.40% | 0.13% | 25.55% | NA |
| Tropical Japonica | 504 | 13.50% | 77.60% | 0.40% | 8.53% | NA |
| Japonica Intermediate | 241 | 60.60% | 19.90% | 0.00% | 19.50% | NA |
| VI/Aromatic | 96 | 9.40% | 0.00% | 3.12% | 87.50% | NA |
| Intermediate | 90 | 54.40% | 17.80% | 2.22% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0202891012 | T -> DEL | LOC_Os02g05850.1 | N | frameshift_variant | Average:34.389; most accessible tissue: Zhenshan97 flag leaf, score: 76.925 | N | N | N | N |
| vg0202891012 | T -> C | LOC_Os02g05850.1 | missense_variant ; p.Tyr1004His; MODERATE | nonsynonymous_codon ; Y1004H | Average:34.389; most accessible tissue: Zhenshan97 flag leaf, score: 76.925 | benign |
-0.724 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0202891012 | NA | 6.83E-06 | mr1029 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202891012 | NA | 2.61E-07 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202891012 | NA | 2.63E-06 | mr1425 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202891012 | NA | 1.70E-12 | mr1449 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202891012 | NA | 4.24E-07 | mr1530 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202891012 | NA | 1.61E-09 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202891012 | NA | 1.48E-18 | mr1715 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202891012 | NA | 7.92E-06 | mr1782 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202891012 | NA | 7.93E-07 | mr1870 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202891012 | NA | 1.85E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202891012 | NA | 1.91E-08 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |