Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0202777372:

Variant ID: vg0202777372 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 2777372
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:

GTTTCCTCGATTTCGCTGGCATGTACTTTGCGGTCCAGTGAGTTAATGCCATAAGATGAGTTTCCACTTACTTTTTGTTGATTGTGATTTTTTTTTGTGC[T/C]
CGCCCAAGTTGCTCATCCTTCTGTACAATAAGTTATAGCATCTCAAATGATGCACAAGTAGGCTTGTTCATATAGAATGCAGATCAGTTTTGCTGAAAGT

Reverse complement sequence

ACTTTCAGCAAAACTGATCTGCATTCTATATGAACAAGCCTACTTGTGCATCATTTGAGATGCTATAACTTATTGTACAGAAGGATGAGCAACTTGGGCG[A/G]
GCACAAAAAAAAATCACAATCAACAAAAAGTAAGTGGAAACTCATCTTATGGCATTAACTCACTGGACCGCAAAGTACATGCCAGCGAAATCGAGGAAAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.50%	10.40%	0.06%	0.00%	NA
All Indica	2759	99.70%	0.30%	0.00%	0.00%	NA
All Japonica	1512	69.40%	30.40%	0.20%	0.00%	NA
Aus	269	97.40%	2.60%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.10%	0.00%	0.00%	NA
Temperate Japonica	767	95.40%	4.20%	0.39%	0.00%	NA
Tropical Japonica	504	25.20%	74.80%	0.00%	0.00%	NA
Japonica Intermediate	241	78.80%	21.20%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	17.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0202777372	T -> C	LOC_Os02g05680.2	5_prime_UTR_variant ; 249.0bp to feature; MODIFIER	silent_mutation	Average:49.463; most accessible tissue: Minghui63 flag leaf, score: 65.44	N	N	N	N
vg0202777372	T -> C	LOC_Os02g05670.1	upstream_gene_variant ; 2652.0bp to feature; MODIFIER	silent_mutation	Average:49.463; most accessible tissue: Minghui63 flag leaf, score: 65.44	N	N	N	N
vg0202777372	T -> C	LOC_Os02g05680.1	intron_variant ; MODIFIER	silent_mutation	Average:49.463; most accessible tissue: Minghui63 flag leaf, score: 65.44	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0202777372	NA	6.49E-07	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202777372	NA	1.76E-06	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202777372	NA	6.45E-06	mr1740	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202777372	NA	1.16E-11	mr1871	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202777372	NA	3.46E-06	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202777372	NA	4.72E-07	mr1347_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202777372	NA	4.87E-10	mr1398_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202777372	NA	6.35E-08	mr1398_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202777372	NA	1.41E-07	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202777372	NA	6.16E-07	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202777372	NA	5.22E-10	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202777372	NA	8.03E-06	mr1449_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202777372	NA	5.59E-13	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202777372	NA	1.19E-07	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202777372	NA	4.63E-14	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202777372	NA	1.05E-07	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202777372	1.77E-06	1.77E-06	mr1610_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202777372	5.84E-07	8.85E-13	mr1696_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202777372	NA	3.15E-09	mr1696_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202777372	NA	5.48E-09	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202777372	NA	7.02E-07	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202777372	NA	3.99E-06	mr1873_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202777372	NA	5.30E-10	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251