\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0202731072:

Variant ID: vg0202731072 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 2731072
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.06, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


GGTTAACAAGGTACCAAGAATACAAGACATCATACATTACTTCTCAGAAACAGGATTATTTTGATCACCATAAGAATGAAGATCGGTATGTTCAAAATGC[A/G]
CTTCCTTTCCTTCTGGTGGTGTTAATTGTACTTTGTTAAGTAAATTGGTATTGCAGGTTCATTTCTTTGTTTTTGTAATTGCAGTTTGAAAGACATGTAC

Reverse complement sequence

GTACATGTCTTTCAAACTGCAATTACAAAAACAAAGAAATGAACCTGCAATACCAATTTACTTAACAAAGTACAATTAACACCACCAGAAGGAAAGGAAG[T/C]
GCATTTTGAACATACCGATCTTCATTCTTATGGTGATCAAAATAATCCTGTTTCTGAGAAGTAATGTATGATGTCTTGTATTCTTGGTACCTTGTTAACC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.80% 48.80% 0.17% 0.17% NA
All Indica  2759 35.80% 63.60% 0.25% 0.29% NA
All Japonica  1512 86.50% 13.50% 0.00% 0.00% NA
Aus  269 17.80% 82.20% 0.00% 0.00% NA
Indica I  595 45.90% 53.40% 0.17% 0.50% NA
Indica II  465 26.20% 72.70% 0.43% 0.65% NA
Indica III  913 38.00% 61.60% 0.33% 0.11% NA
Indica Intermediate  786 31.40% 68.30% 0.13% 0.13% NA
Temperate Japonica  767 80.60% 19.40% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 80.50% 19.50% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 62.20% 36.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0202731072 A -> G LOC_Os02g05620.1 downstream_gene_variant ; 4814.0bp to feature; MODIFIER silent_mutation Average:32.642; most accessible tissue: Callus, score: 71.467 N N N N
vg0202731072 A -> G LOC_Os02g05610.1 intron_variant ; MODIFIER silent_mutation Average:32.642; most accessible tissue: Callus, score: 71.467 N N N N
vg0202731072 A -> DEL N N silent_mutation Average:32.642; most accessible tissue: Callus, score: 71.467 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0202731072 7.38E-06 7.38E-06 mr1166 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202731072 4.68E-09 6.78E-12 mr1210 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202731072 NA 4.13E-07 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202731072 NA 2.46E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202731072 4.05E-09 3.32E-11 mr1305 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202731072 2.59E-11 2.59E-11 mr1409 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202731072 1.10E-06 2.44E-08 mr1515 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202731072 7.69E-06 2.80E-09 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202731072 2.30E-08 3.88E-11 mr1586 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202731072 2.21E-06 2.21E-06 mr1649 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202731072 5.05E-07 7.72E-09 mr1765 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202731072 NA 9.95E-07 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202731072 1.50E-06 1.49E-07 mr1793 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202731072 5.67E-07 3.29E-10 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202731072 NA 2.78E-06 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202731072 NA 7.53E-07 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202731072 6.79E-06 4.49E-11 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202731072 NA 2.03E-07 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251