RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0202731072:

Variant ID: vg0202731072 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 2731072
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.06, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

GGTTAACAAGGTACCAAGAATACAAGACATCATACATTACTTCTCAGAAACAGGATTATTTTGATCACCATAAGAATGAAGATCGGTATGTTCAAAATGC[A/G]
CTTCCTTTCCTTCTGGTGGTGTTAATTGTACTTTGTTAAGTAAATTGGTATTGCAGGTTCATTTCTTTGTTTTTGTAATTGCAGTTTGAAAGACATGTAC

Reverse complement sequence

GTACATGTCTTTCAAACTGCAATTACAAAAACAAAGAAATGAACCTGCAATACCAATTTACTTAACAAAGTACAATTAACACCACCAGAAGGAAAGGAAG[T/C]
GCATTTTGAACATACCGATCTTCATTCTTATGGTGATCAAAATAATCCTGTTTCTGAGAAGTAATGTATGATGTCTTGTATTCTTGGTACCTTGTTAACC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.80%	48.80%	0.17%	0.17%	NA
All Indica	2759	35.80%	63.60%	0.25%	0.29%	NA
All Japonica	1512	86.50%	13.50%	0.00%	0.00%	NA
Aus	269	17.80%	82.20%	0.00%	0.00%	NA
Indica I	595	45.90%	53.40%	0.17%	0.50%	NA
Indica II	465	26.20%	72.70%	0.43%	0.65%	NA
Indica III	913	38.00%	61.60%	0.33%	0.11%	NA
Indica Intermediate	786	31.40%	68.30%	0.13%	0.13%	NA
Temperate Japonica	767	80.60%	19.40%	0.00%	0.00%	NA
Tropical Japonica	504	98.40%	1.60%	0.00%	0.00%	NA
Japonica Intermediate	241	80.50%	19.50%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	62.20%	36.70%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0202731072	A -> G	LOC_Os02g05620.1	downstream_gene_variant ; 4814.0bp to feature; MODIFIER	silent_mutation	Average:32.642; most accessible tissue: Callus, score: 71.467	N	N	N	N
vg0202731072	A -> G	LOC_Os02g05610.1	intron_variant ; MODIFIER	silent_mutation	Average:32.642; most accessible tissue: Callus, score: 71.467	N	N	N	N
vg0202731072	A -> DEL	N	N	silent_mutation	Average:32.642; most accessible tissue: Callus, score: 71.467	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0202731072	7.38E-06	7.38E-06	mr1166	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202731072	4.68E-09	6.78E-12	mr1210	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202731072	NA	4.13E-07	mr1277	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202731072	NA	2.46E-06	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202731072	4.05E-09	3.32E-11	mr1305	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202731072	2.59E-11	2.59E-11	mr1409	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202731072	1.10E-06	2.44E-08	mr1515	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202731072	7.69E-06	2.80E-09	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202731072	2.30E-08	3.88E-11	mr1586	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202731072	2.21E-06	2.21E-06	mr1649	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 18 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0202731072:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact