\
| Variant ID: vg0202731072 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 2731072 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.06, others allele: 0.00, population size: 263. )
GGTTAACAAGGTACCAAGAATACAAGACATCATACATTACTTCTCAGAAACAGGATTATTTTGATCACCATAAGAATGAAGATCGGTATGTTCAAAATGC[A/G]
CTTCCTTTCCTTCTGGTGGTGTTAATTGTACTTTGTTAAGTAAATTGGTATTGCAGGTTCATTTCTTTGTTTTTGTAATTGCAGTTTGAAAGACATGTAC
GTACATGTCTTTCAAACTGCAATTACAAAAACAAAGAAATGAACCTGCAATACCAATTTACTTAACAAAGTACAATTAACACCACCAGAAGGAAAGGAAG[T/C]
GCATTTTGAACATACCGATCTTCATTCTTATGGTGATCAAAATAATCCTGTTTCTGAGAAGTAATGTATGATGTCTTGTATTCTTGGTACCTTGTTAACC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.80% | 48.80% | 0.17% | 0.17% | NA |
| All Indica | 2759 | 35.80% | 63.60% | 0.25% | 0.29% | NA |
| All Japonica | 1512 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 17.80% | 82.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 45.90% | 53.40% | 0.17% | 0.50% | NA |
| Indica II | 465 | 26.20% | 72.70% | 0.43% | 0.65% | NA |
| Indica III | 913 | 38.00% | 61.60% | 0.33% | 0.11% | NA |
| Indica Intermediate | 786 | 31.40% | 68.30% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 80.60% | 19.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.50% | 19.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 62.20% | 36.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0202731072 | A -> G | LOC_Os02g05620.1 | downstream_gene_variant ; 4814.0bp to feature; MODIFIER | silent_mutation | Average:32.642; most accessible tissue: Callus, score: 71.467 | N | N | N | N |
| vg0202731072 | A -> G | LOC_Os02g05610.1 | intron_variant ; MODIFIER | silent_mutation | Average:32.642; most accessible tissue: Callus, score: 71.467 | N | N | N | N |
| vg0202731072 | A -> DEL | N | N | silent_mutation | Average:32.642; most accessible tissue: Callus, score: 71.467 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0202731072 | 7.38E-06 | 7.38E-06 | mr1166 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202731072 | 4.68E-09 | 6.78E-12 | mr1210 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202731072 | NA | 4.13E-07 | mr1277 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202731072 | NA | 2.46E-06 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202731072 | 4.05E-09 | 3.32E-11 | mr1305 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202731072 | 2.59E-11 | 2.59E-11 | mr1409 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202731072 | 1.10E-06 | 2.44E-08 | mr1515 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202731072 | 7.69E-06 | 2.80E-09 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202731072 | 2.30E-08 | 3.88E-11 | mr1586 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202731072 | 2.21E-06 | 2.21E-06 | mr1649 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202731072 | 5.05E-07 | 7.72E-09 | mr1765 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202731072 | NA | 9.95E-07 | mr1788 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202731072 | 1.50E-06 | 1.49E-07 | mr1793 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202731072 | 5.67E-07 | 3.29E-10 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202731072 | NA | 2.78E-06 | mr1409_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202731072 | NA | 7.53E-07 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202731072 | 6.79E-06 | 4.49E-11 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202731072 | NA | 2.03E-07 | mr1793_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |