Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0202716112:

Variant ID: vg0202716112 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 2716112
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGACACGAGGGCCTTCGGCCAGATCTGCCCAAACAATCCAACCCGTGAGGAATCAAGTCAAGACCAAGAGGTTTGACTGGGCGAAGCCACATGGCGAAC[T/C]
GTATGGCGAAGATTAAATGACTGAGTCTAAGCTCAACAAAGCATATCGGTCGCGGGCGAAGGCCATGACTGAAGTCCATGGCGAAGCCCCTAGGCAAAGC

Reverse complement sequence

GCTTTGCCTAGGGGCTTCGCCATGGACTTCAGTCATGGCCTTCGCCCGCGACCGATATGCTTTGTTGAGCTTAGACTCAGTCATTTAATCTTCGCCATAC[A/G]
GTTCGCCATGTGGCTTCGCCCAGTCAAACCTCTTGGTCTTGACTTGATTCCTCACGGGTTGGATTGTTTGGGCAGATCTGGCCGAAGGCCCTCGTGTCAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.20%	9.20%	0.74%	56.83%	NA
All Indica	2759	6.90%	3.70%	1.01%	88.44%	NA
All Japonica	1512	84.70%	14.60%	0.13%	0.60%	NA
Aus	269	18.20%	2.60%	1.12%	78.07%	NA
Indica I	595	11.90%	0.00%	1.01%	87.06%	NA
Indica II	465	2.20%	1.50%	1.29%	95.05%	NA
Indica III	913	6.90%	5.40%	0.77%	86.97%	NA
Indica Intermediate	786	5.90%	5.70%	1.15%	87.28%	NA
Temperate Japonica	767	79.50%	20.20%	0.13%	0.13%	NA
Tropical Japonica	504	97.60%	1.20%	0.00%	1.19%	NA
Japonica Intermediate	241	73.90%	24.90%	0.41%	0.83%	NA
VI/Aromatic	96	0.00%	96.90%	0.00%	3.12%	NA
Intermediate	90	56.70%	14.40%	2.22%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0202716112	T -> DEL	N	N	silent_mutation	Average:18.737; most accessible tissue: Callus, score: 50.264	N	N	N	N
vg0202716112	T -> C	LOC_Os02g05580.1	upstream_gene_variant ; 4790.0bp to feature; MODIFIER	silent_mutation	Average:18.737; most accessible tissue: Callus, score: 50.264	N	N	N	N
vg0202716112	T -> C	LOC_Os02g05590.1	downstream_gene_variant ; 3153.0bp to feature; MODIFIER	silent_mutation	Average:18.737; most accessible tissue: Callus, score: 50.264	N	N	N	N
vg0202716112	T -> C	LOC_Os02g05590-LOC_Os02g05600	intergenic_region ; MODIFIER	silent_mutation	Average:18.737; most accessible tissue: Callus, score: 50.264	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0202716112	NA	1.46E-06	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202716112	2.86E-08	NA	mr1210	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202716112	3.77E-07	1.44E-10	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202716112	9.43E-08	NA	mr1305	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202716112	9.21E-07	1.83E-09	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202716112	5.18E-10	5.18E-10	mr1409	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202716112	NA	1.25E-06	mr1515	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202716112	1.60E-07	7.65E-14	mr1585	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202716112	NA	2.60E-09	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202716112	1.94E-07	NA	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202716112	NA	1.61E-08	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202716112	2.32E-06	NA	mr1682	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202716112	NA	1.39E-06	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202716112	NA	3.27E-06	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202716112	5.38E-07	NA	mr1793	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202716112	8.08E-06	9.34E-07	mr1793	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202716112	NA	1.14E-07	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202716112	2.12E-07	NA	mr1305_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202716112	3.47E-07	9.71E-11	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202716112	NA	2.33E-07	mr1409_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202716112	NA	2.42E-07	mr1559_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202716112	8.94E-08	1.39E-15	mr1585_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202716112	5.61E-06	7.16E-12	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202716112	8.63E-06	8.63E-06	mr1649_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202716112	NA	1.14E-06	mr1765_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202716112	NA	2.81E-07	mr1793_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251