Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0202699054:

Variant ID: vg0202699054 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 2699054
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCCGCGCTCCCGCTCGACGGTGGCGTCACATGCGACTTTCTGCTTCGGCTTCTCTGCTCTGGGAGCATGGCCGGGGCCGATGCGGCGTGTCGGCTGGACC[T/C]
GAGGGCGGTGAAGCTGCTGGAGAACACGAGGAGCAAGCTCGCCATGCCGAGCAACTGCTAGCAGGAGGCGTACCGGAGGTTGTTCGCCAGCTGCGGCGAC

Reverse complement sequence

GTCGCCGCAGCTGGCGAACAACCTCCGGTACGCCTCCTGCTAGCAGTTGCTCGGCATGGCGAGCTTGCTCCTCGTGTTCTCCAGCAGCTTCACCGCCCTC[A/G]
GGTCCAGCCGACACGCCGCATCGGCCCCGGCCATGCTCCCAGAGCAGAGAAGCCGAAGCAGAAAGTCGCATGTGACGCCACCGTCGAGCGGGAGCGCGGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.30%	8.70%	0.66%	56.31%	NA
All Indica	2759	7.90%	3.70%	0.87%	87.53%	NA
All Japonica	1512	86.40%	12.80%	0.07%	0.66%	NA
Aus	269	18.20%	2.20%	1.12%	78.44%	NA
Indica I	595	12.40%	0.00%	1.18%	86.39%	NA
Indica II	465	3.20%	1.70%	1.29%	93.76%	NA
Indica III	913	8.00%	5.30%	0.66%	86.09%	NA
Indica Intermediate	786	7.00%	6.00%	0.64%	86.39%	NA
Temperate Japonica	767	80.60%	19.30%	0.00%	0.13%	NA
Tropical Japonica	504	98.20%	0.40%	0.00%	1.39%	NA
Japonica Intermediate	241	80.50%	18.30%	0.41%	0.83%	NA
VI/Aromatic	96	0.00%	96.90%	0.00%	3.12%	NA
Intermediate	90	54.40%	17.80%	3.33%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0202699054	T -> DEL	LOC_Os02g05560.1	N	frameshift_variant	Average:17.99; most accessible tissue: Callus, score: 98.602	N	N	N	N
vg0202699054	T -> C	LOC_Os02g05560.1	synonymous_variant ; p.Pro740Pro; LOW	synonymous_codon	Average:17.99; most accessible tissue: Callus, score: 98.602	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0202699054	2.72E-10	NA	mr1210	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054	2.81E-08	1.56E-11	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054	8.30E-06	NA	mr1280	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054	7.99E-11	NA	mr1305	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054	9.12E-08	2.25E-10	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054	5.98E-07	NA	mr1409	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054	3.31E-10	3.31E-10	mr1409	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054	NA	9.81E-07	mr1515	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054	1.89E-06	7.07E-13	mr1585	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054	NA	1.79E-09	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054	3.31E-09	NA	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054	2.84E-06	2.88E-09	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054	NA	2.27E-07	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054	NA	1.67E-06	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054	5.08E-07	NA	mr1793	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054	5.76E-06	7.24E-07	mr1793	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054	3.03E-06	3.03E-06	mr1166_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054	1.94E-07	NA	mr1305_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054	2.19E-08	4.88E-12	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054	8.75E-06	2.74E-08	mr1409_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054	NA	2.74E-06	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054	1.85E-06	2.96E-08	mr1559_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054	1.15E-06	6.42E-15	mr1585_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054	6.13E-07	4.76E-13	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054	8.67E-06	8.67E-06	mr1649_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054	NA	1.02E-06	mr1765_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054	6.95E-07	9.14E-09	mr1793_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251