\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0202699054:

Variant ID: vg0202699054 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 2699054
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCGCGCTCCCGCTCGACGGTGGCGTCACATGCGACTTTCTGCTTCGGCTTCTCTGCTCTGGGAGCATGGCCGGGGCCGATGCGGCGTGTCGGCTGGACC[T/C]
GAGGGCGGTGAAGCTGCTGGAGAACACGAGGAGCAAGCTCGCCATGCCGAGCAACTGCTAGCAGGAGGCGTACCGGAGGTTGTTCGCCAGCTGCGGCGAC

Reverse complement sequence

GTCGCCGCAGCTGGCGAACAACCTCCGGTACGCCTCCTGCTAGCAGTTGCTCGGCATGGCGAGCTTGCTCCTCGTGTTCTCCAGCAGCTTCACCGCCCTC[A/G]
GGTCCAGCCGACACGCCGCATCGGCCCCGGCCATGCTCCCAGAGCAGAGAAGCCGAAGCAGAAAGTCGCATGTGACGCCACCGTCGAGCGGGAGCGCGGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.30% 8.70% 0.66% 56.31% NA
All Indica  2759 7.90% 3.70% 0.87% 87.53% NA
All Japonica  1512 86.40% 12.80% 0.07% 0.66% NA
Aus  269 18.20% 2.20% 1.12% 78.44% NA
Indica I  595 12.40% 0.00% 1.18% 86.39% NA
Indica II  465 3.20% 1.70% 1.29% 93.76% NA
Indica III  913 8.00% 5.30% 0.66% 86.09% NA
Indica Intermediate  786 7.00% 6.00% 0.64% 86.39% NA
Temperate Japonica  767 80.60% 19.30% 0.00% 0.13% NA
Tropical Japonica  504 98.20% 0.40% 0.00% 1.39% NA
Japonica Intermediate  241 80.50% 18.30% 0.41% 0.83% NA
VI/Aromatic  96 0.00% 96.90% 0.00% 3.12% NA
Intermediate  90 54.40% 17.80% 3.33% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0202699054 T -> DEL LOC_Os02g05560.1 N frameshift_variant Average:17.99; most accessible tissue: Callus, score: 98.602 N N N N
vg0202699054 T -> C LOC_Os02g05560.1 synonymous_variant ; p.Pro740Pro; LOW synonymous_codon Average:17.99; most accessible tissue: Callus, score: 98.602 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0202699054 2.72E-10 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054 2.81E-08 1.56E-11 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054 8.30E-06 NA mr1280 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054 7.99E-11 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054 9.12E-08 2.25E-10 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054 5.98E-07 NA mr1409 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054 3.31E-10 3.31E-10 mr1409 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054 NA 9.81E-07 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054 1.89E-06 7.07E-13 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054 NA 1.79E-09 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054 3.31E-09 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054 2.84E-06 2.88E-09 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054 NA 2.27E-07 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054 NA 1.67E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054 5.08E-07 NA mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054 5.76E-06 7.24E-07 mr1793 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054 3.03E-06 3.03E-06 mr1166_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054 1.94E-07 NA mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054 2.19E-08 4.88E-12 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054 8.75E-06 2.74E-08 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054 NA 2.74E-06 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054 1.85E-06 2.96E-08 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054 1.15E-06 6.42E-15 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054 6.13E-07 4.76E-13 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054 8.67E-06 8.67E-06 mr1649_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054 NA 1.02E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202699054 6.95E-07 9.14E-09 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251