\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0202698817:

Variant ID: vg0202698817 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 2698817
Reference Allele: TGAGAAlternative Allele: T,AGAGA,TGA
Primary Allele: TGAGASecondary Allele: AGAGA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCGCCTGCGTAAACCAAACACCAAATATTCTGGTCAGGAGTGGGTCATGTAATGATTCGGGCCCACGAGCCCATGTAAGAGGGTTGGTGAGTGTGTGTG[TGAGA/T,AGAGA,TGA]
GAGAGAGAGAGGGGAACCAACTGTATTTAGCTGGCAGGGGATACTTTGTTTTGATTGGATTTGGAACTCGATGACGGTGTTGGCGGCGGCGGCTCTGTCC

Reverse complement sequence

GGACAGAGCCGCCGCCGCCAACACCGTCATCGAGTTCCAAATCCAATCAAAACAAAGTATCCCCTGCCAGCTAAATACAGTTGGTTCCCCTCTCTCTCTC[TCTCA/A,TCTCT,TCA]
CACACACACTCACCAACCCTCTTACATGGGCTCGTGGGCCCGAATCATTACATGACCCACTCCTGACCAGAATATTTGGTGTTTGGTTTACGCAGGCGCC

Allele Frequencies:

Populations Population SizeFrequency of TGAGA(primary allele) Frequency of AGAGA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.60% 5.50% 2.43% 55.95% T: 4.46%
All Indica  2759 7.80% 0.00% 1.92% 86.77% T: 3.48%
All Japonica  1512 78.60% 16.70% 3.70% 0.66% T: 0.33%
Aus  269 17.50% 0.00% 1.49% 78.81% T: 2.23%
Indica I  595 10.60% 0.00% 3.19% 86.22% NA
Indica II  465 4.10% 0.00% 1.29% 93.33% T: 1.29%
Indica III  913 8.30% 0.10% 1.86% 84.78% T: 4.93%
Indica Intermediate  786 7.30% 0.00% 1.40% 85.62% T: 5.73%
Temperate Japonica  767 66.10% 27.00% 6.78% 0.13% NA
Tropical Japonica  504 98.20% 0.20% 0.00% 1.39% T: 0.20%
Japonica Intermediate  241 77.60% 18.30% 1.66% 0.83% T: 1.66%
VI/Aromatic  96 1.00% 0.00% 0.00% 2.08% T: 96.88%
Intermediate  90 47.80% 8.90% 2.22% 28.89% T: 12.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0202698817 TGAGA -> DEL N N silent_mutation Average:19.144; most accessible tissue: Callus, score: 99.917 N N N N
vg0202698817 TGAGA -> T LOC_Os02g05570.1 downstream_gene_variant ; 3988.0bp to feature; MODIFIER silent_mutation Average:19.144; most accessible tissue: Callus, score: 99.917 N N N N
vg0202698817 TGAGA -> T LOC_Os02g05560.1 intron_variant ; MODIFIER silent_mutation Average:19.144; most accessible tissue: Callus, score: 99.917 N N N N
vg0202698817 TGAGA -> TGA LOC_Os02g05570.1 downstream_gene_variant ; 3986.0bp to feature; MODIFIER N Average:19.144; most accessible tissue: Callus, score: 99.917 N N N N
vg0202698817 TGAGA -> TGA LOC_Os02g05560.1 intron_variant ; MODIFIER N Average:19.144; most accessible tissue: Callus, score: 99.917 N N N N
vg0202698817 TGAGA -> AGAGA LOC_Os02g05570.1 downstream_gene_variant ; 3989.0bp to feature; MODIFIER silent_mutation Average:19.144; most accessible tissue: Callus, score: 99.917 N N N N
vg0202698817 TGAGA -> AGAGA LOC_Os02g05560.1 intron_variant ; MODIFIER silent_mutation Average:19.144; most accessible tissue: Callus, score: 99.917 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0202698817 3.33E-08 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202698817 NA 2.77E-07 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202698817 2.99E-08 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202698817 NA 8.53E-07 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202698817 1.59E-06 1.59E-06 mr1409 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202698817 7.11E-06 NA mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202698817 NA 7.25E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202698817 4.60E-08 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202698817 NA 1.19E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202698817 3.40E-06 1.13E-06 mr1614 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202698817 3.22E-06 6.14E-07 mr1614 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202698817 2.70E-06 NA mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202698817 NA 6.10E-06 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202698817 NA 7.15E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202698817 1.31E-08 NA mr1793 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202698817 1.54E-06 9.62E-08 mr1793 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202698817 5.35E-06 5.35E-06 mr1899 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202698817 1.29E-06 1.29E-06 mr1899 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202698817 NA 3.01E-06 mr1937 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202698817 5.41E-08 NA mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202698817 1.85E-06 1.40E-08 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202698817 NA 7.65E-06 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202698817 NA 2.73E-06 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202698817 7.63E-08 7.38E-08 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202698817 NA 2.19E-09 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202698817 NA 9.61E-06 mr1703_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202698817 1.02E-08 NA mr1793_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202698817 1.66E-07 1.31E-09 mr1793_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251