\
| Variant ID: vg0202692022 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 2692022 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.02, others allele: 0.00, population size: 55. )
TATTTGGTAGTGGTAGGTTTAGGTAGTATAATACCTAGGGTTTAGTTATATGGGAGTCGATTGTGGAGTAGGATAGCATATCGGCTAGGCTCTATATTTT[G/A]
TGTGGAGGTTCTAGAGGATTGGTGGCTAGAGGGGATTAAGCAACTACTGTCGCTTATATTTTATGCGAAGGCTCTCATGGTTTGGACGATAGGAAAAATA
TATTTTTCCTATCGTCCAAACCATGAGAGCCTTCGCATAAAATATAAGCGACAGTAGTTGCTTAATCCCCTCTAGCCACCAATCCTCTAGAACCTCCACA[C/T]
AAAATATAGAGCCTAGCCGATATGCTATCCTACTCCACAATCGACTCCCATATAACTAAACCCTAGGTATTATACTACCTAAACCTACCACTACCAAATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.60% | 5.90% | 8.13% | 44.33% | NA |
| All Indica | 2759 | 10.90% | 7.20% | 11.42% | 70.46% | NA |
| All Japonica | 1512 | 96.40% | 0.10% | 0.20% | 3.37% | NA |
| Aus | 269 | 20.10% | 27.90% | 22.68% | 29.37% | NA |
| Indica I | 595 | 13.10% | 0.80% | 11.09% | 74.96% | NA |
| Indica II | 465 | 4.50% | 13.30% | 10.54% | 71.61% | NA |
| Indica III | 913 | 11.60% | 6.20% | 13.69% | 68.46% | NA |
| Indica Intermediate | 786 | 12.20% | 9.50% | 9.54% | 68.70% | NA |
| Temperate Japonica | 767 | 95.60% | 0.10% | 0.26% | 4.04% | NA |
| Tropical Japonica | 504 | 97.80% | 0.00% | 0.00% | 2.18% | NA |
| Japonica Intermediate | 241 | 95.90% | 0.00% | 0.41% | 3.73% | NA |
| VI/Aromatic | 96 | 96.90% | 2.10% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 70.00% | 2.20% | 5.56% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0202692022 | G -> A | LOC_Os02g05560.1 | upstream_gene_variant ; 3667.0bp to feature; MODIFIER | silent_mutation | Average:33.294; most accessible tissue: Callus, score: 55.755 | N | N | N | N |
| vg0202692022 | G -> A | LOC_Os02g05550-LOC_Os02g05560 | intergenic_region ; MODIFIER | silent_mutation | Average:33.294; most accessible tissue: Callus, score: 55.755 | N | N | N | N |
| vg0202692022 | G -> DEL | N | N | silent_mutation | Average:33.294; most accessible tissue: Callus, score: 55.755 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0202692022 | NA | 8.74E-06 | mr1177 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202692022 | NA | 1.01E-08 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202692022 | NA | 2.30E-08 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202692022 | NA | 4.55E-09 | mr1503 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202692022 | NA | 2.43E-07 | mr1180_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |