\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0202626444:

Variant ID: vg0202626444 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 2626444
Reference Allele: CTAlternative Allele: CTT,CTTT,CTTTT,TT,C
Primary Allele: CTSecondary Allele: CTT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAACCAATACACACTTAAGTTTGAATGTGAATATGCCTTGTATTTGTGGACGGAGGGAGTATCATTCATTCCATAGTACTAAACACTACCGTGATTTTGA[CT/CTT,CTTT,CTTTT,TT,C]
TTTTTTTCCCTTTTACTGCTACCGATTTCTCCAATAATTTTACATAACACGGGTAACAATGTTTTCGCTTCAATTTACATGCACCTGGAACTGAAACCCA

Reverse complement sequence

TGGGTTTCAGTTCCAGGTGCATGTAAATTGAAGCGAAAACATTGTTACCCGTGTTATGTAAAATTATTGGAGAAATCGGTAGCAGTAAAAGGGAAAAAAA[AG/AAG,AAAG,AAAAG,AA,G]
TCAAAATCACGGTAGTGTTTAGTACTATGGAATGAATGATACTCCCTCCGTCCACAAATACAAGGCATATTCACATTCAAACTTAAGTGTGTATTGGTTC

Allele Frequencies:

Populations Population SizeFrequency of CT(primary allele) Frequency of CTT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.00% 17.00% 1.14% 0.00% CTTT: 5.63%; TT: 1.99%; CTTTT: 0.15%; C: 0.06%
All Indica  2759 68.80% 28.60% 0.22% 0.00% CTTT: 2.28%; TT: 0.04%; CTTTT: 0.04%; C: 0.04%
All Japonica  1512 91.20% 0.10% 2.25% 0.00% TT: 5.89%; CTTT: 0.40%; C: 0.13%
Aus  269 20.10% 4.10% 3.72% 0.00% CTTT: 69.89%; CTTTT: 2.23%
Indica I  595 87.20% 12.40% 0.34% 0.00% NA
Indica II  465 75.90% 21.70% 0.43% 0.00% CTTT: 1.94%
Indica III  913 46.90% 48.40% 0.11% 0.00% CTTT: 4.27%; CTTTT: 0.11%; C: 0.11%; TT: 0.11%
Indica Intermediate  786 76.20% 21.80% 0.13% 0.00% CTTT: 1.91%
Temperate Japonica  767 97.90% 0.00% 1.17% 0.00% TT: 0.65%; C: 0.26%
Tropical Japonica  504 81.50% 0.20% 3.97% 0.00% TT: 13.29%; CTTT: 0.99%
Japonica Intermediate  241 90.00% 0.40% 2.07% 0.00% TT: 7.05%; CTTT: 0.41%
VI/Aromatic  96 97.90% 0.00% 1.04% 0.00% CTTT: 1.04%
Intermediate  90 80.00% 3.30% 3.33% 0.00% CTTT: 8.89%; TT: 4.44%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0202626444 CT -> CTTT LOC_Os02g05450.1 downstream_gene_variant ; 136.0bp to feature; MODIFIER silent_mutation Average:88.9; most accessible tissue: Minghui63 flag leaf, score: 95.859 N N N N
vg0202626444 CT -> CTTT LOC_Os02g05450-LOC_Os02g05460 intergenic_region ; MODIFIER silent_mutation Average:88.9; most accessible tissue: Minghui63 flag leaf, score: 95.859 N N N N
vg0202626444 CT -> TT LOC_Os02g05450.1 downstream_gene_variant ; 134.0bp to feature; MODIFIER silent_mutation Average:88.9; most accessible tissue: Minghui63 flag leaf, score: 95.859 N N N N
vg0202626444 CT -> TT LOC_Os02g05450-LOC_Os02g05460 intergenic_region ; MODIFIER silent_mutation Average:88.9; most accessible tissue: Minghui63 flag leaf, score: 95.859 N N N N
vg0202626444 CT -> CTTTT LOC_Os02g05450.1 downstream_gene_variant ; 136.0bp to feature; MODIFIER silent_mutation Average:88.9; most accessible tissue: Minghui63 flag leaf, score: 95.859 N N N N
vg0202626444 CT -> CTTTT LOC_Os02g05450-LOC_Os02g05460 intergenic_region ; MODIFIER silent_mutation Average:88.9; most accessible tissue: Minghui63 flag leaf, score: 95.859 N N N N
vg0202626444 CT -> C LOC_Os02g05450.1 downstream_gene_variant ; 135.0bp to feature; MODIFIER silent_mutation Average:88.9; most accessible tissue: Minghui63 flag leaf, score: 95.859 N N N N
vg0202626444 CT -> C LOC_Os02g05450-LOC_Os02g05460 intergenic_region ; MODIFIER silent_mutation Average:88.9; most accessible tissue: Minghui63 flag leaf, score: 95.859 N N N N
vg0202626444 CT -> CTT LOC_Os02g05450.1 downstream_gene_variant ; 136.0bp to feature; MODIFIER silent_mutation Average:88.9; most accessible tissue: Minghui63 flag leaf, score: 95.859 N N N N
vg0202626444 CT -> CTT LOC_Os02g05450-LOC_Os02g05460 intergenic_region ; MODIFIER silent_mutation Average:88.9; most accessible tissue: Minghui63 flag leaf, score: 95.859 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0202626444 CT C -0.1 0.0 -0.03 0.05 0.01 0.05
vg0202626444 CT CTT -0.14 -0.11 -0.09 -0.05 -0.05 -0.02
vg0202626444 CT CTTT -0.14 -0.01 0.02 -0.05 0.0 0.05
vg0202626444 CT CTTTT 0.04 -0.03 -0.03 -0.04 0.01 0.07
vg0202626444 CT TT -0.05 0.02 0.01 0.0 -0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0202626444 NA 2.83E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202626444 1.76E-07 1.76E-07 mr1610_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251