Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0202558275:

Variant ID: vg0202558275 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 2558275
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 354. )

Flanking Sequence (100 bp) in Reference Genome:

TTTGGGTGTCCTAGTGTTTGCAAATCTAAAATTTGTAACATGCTAGTATATGTACTTTTTTTTAATGACTGCGTTAGATTATTTGTCCTGCTAAGCACTT[C/T]
GATGTCCTGCTTTGTACTTTGATGACTGTTAGATTATTATCCTTTGTATGCCAAGGACAGTGGAGGAACCATAGGAAGTCGAAGGTCTTTATGGACCAAA

Reverse complement sequence

TTTGGTCCATAAAGACCTTCGACTTCCTATGGTTCCTCCACTGTCCTTGGCATACAAAGGATAATAATCTAACAGTCATCAAAGTACAAAGCAGGACATC[G/A]
AAGTGCTTAGCAGGACAAATAATCTAACGCAGTCATTAAAAAAAAGTACATATACTAGCATGTTACAAATTTTAGATTTGCAAACACTAGGACACCCAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.60%	10.90%	0.51%	0.00%	NA
All Indica	2759	99.70%	0.30%	0.04%	0.00%	NA
All Japonica	1512	66.10%	32.30%	1.52%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.50%	0.13%	0.00%	NA
Temperate Japonica	767	40.70%	56.60%	2.74%	0.00%	NA
Tropical Japonica	504	96.20%	3.80%	0.00%	0.00%	NA
Japonica Intermediate	241	84.20%	14.90%	0.83%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	17.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0202558275	C -> T	LOC_Os02g05320.1	downstream_gene_variant ; 1997.0bp to feature; MODIFIER	silent_mutation	Average:82.553; most accessible tissue: Callus, score: 89.229	N	N	N	N
vg0202558275	C -> T	LOC_Os02g05320.2	downstream_gene_variant ; 2000.0bp to feature; MODIFIER	silent_mutation	Average:82.553; most accessible tissue: Callus, score: 89.229	N	N	N	N
vg0202558275	C -> T	LOC_Os02g05320.3	downstream_gene_variant ; 2000.0bp to feature; MODIFIER	silent_mutation	Average:82.553; most accessible tissue: Callus, score: 89.229	N	N	N	N
vg0202558275	C -> T	LOC_Os02g05320.5	downstream_gene_variant ; 1997.0bp to feature; MODIFIER	silent_mutation	Average:82.553; most accessible tissue: Callus, score: 89.229	N	N	N	N
vg0202558275	C -> T	LOC_Os02g05330.1	intron_variant ; MODIFIER	silent_mutation	Average:82.553; most accessible tissue: Callus, score: 89.229	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0202558275	C	T	0.0	0.0	-0.01	0.0	0.0	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0202558275	3.09E-06	NA	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0202558275	NA	1.18E-13	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0202558275	NA	1.49E-13	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0202558275	NA	1.07E-09	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202558275	NA	9.60E-07	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202558275	NA	3.29E-06	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202558275	NA	2.19E-07	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202558275	NA	2.23E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202558275	NA	1.19E-06	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202558275	3.63E-06	4.35E-10	mr1946_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202558275	3.63E-06	4.35E-10	mr1948_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202558275	NA	9.03E-09	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251