\
| Variant ID: vg0202518756 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 2518756 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GAGGGCCGTCCATTATTTTAAATTTCATTTTTGGTAGTTAAAGGCCGTGTTTAGTTTCAAAGTTTTTCTTCAAACTTCAAACTTTTCTATCACATCAAAA[C/T]
TTTTCTACACACACAAACTTTCAACTTTTCCGTCACATCGTTCCAATTTCAACCAAATTTCTAATTTTGGCGTGAACTAAACACAGCCAAAATTATGAAA
TTTCATAATTTTGGCTGTGTTTAGTTCACGCCAAAATTAGAAATTTGGTTGAAATTGGAACGATGTGACGGAAAAGTTGAAAGTTTGTGTGTGTAGAAAA[G/A]
TTTTGATGTGATAGAAAAGTTTGAAGTTTGAAGAAAAACTTTGAAACTAAACACGGCCTTTAACTACCAAAAATGAAATTTAAAATAATGGACGGCCCTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.70% | 1.10% | 0.78% | 3.45% | NA |
| All Indica | 2759 | 97.30% | 0.00% | 0.04% | 2.68% | NA |
| All Japonica | 1512 | 94.30% | 3.30% | 1.92% | 0.46% | NA |
| Aus | 269 | 98.10% | 0.00% | 0.00% | 1.86% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.00% | 0.00% | 1.08% | NA |
| Indica III | 913 | 96.20% | 0.00% | 0.00% | 3.83% | NA |
| Indica Intermediate | 786 | 95.50% | 0.00% | 0.13% | 4.33% | NA |
| Temperate Japonica | 767 | 93.40% | 3.10% | 3.52% | 0.00% | NA |
| Tropical Japonica | 504 | 95.00% | 4.60% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 95.90% | 1.20% | 0.41% | 2.49% | NA |
| VI/Aromatic | 96 | 21.90% | 0.00% | 4.17% | 73.96% | NA |
| Intermediate | 90 | 88.90% | 1.10% | 3.33% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0202518756 | C -> T | LOC_Os02g05244.1 | 3_prime_UTR_variant ; 1448.0bp to feature; MODIFIER | silent_mutation | Average:51.373; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0202518756 | C -> T | LOC_Os02g05250.1 | downstream_gene_variant ; 2468.0bp to feature; MODIFIER | silent_mutation | Average:51.373; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0202518756 | C -> T | LOC_Os02g05244.2 | intron_variant ; MODIFIER | silent_mutation | Average:51.373; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0202518756 | C -> DEL | N | N | silent_mutation | Average:51.373; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0202518756 | NA | 4.85E-06 | mr1071 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202518756 | 4.69E-08 | 9.22E-08 | mr1078 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202518756 | NA | 2.17E-06 | mr1080 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202518756 | 2.60E-07 | 4.09E-07 | mr1100 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202518756 | 1.67E-06 | 1.67E-06 | mr1141 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202518756 | NA | 6.78E-06 | mr1395 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202518756 | 5.30E-06 | NA | mr1517 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202518756 | 2.40E-07 | 2.11E-07 | mr1613 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202518756 | 4.58E-07 | 1.39E-07 | mr1619 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202518756 | 2.84E-07 | 2.84E-07 | mr1795 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202518756 | 1.42E-08 | 1.40E-08 | mr1962 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202518756 | 1.22E-06 | 1.49E-06 | mr1982 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |