Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0202518756:

Variant ID: vg0202518756 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 2518756
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAGGGCCGTCCATTATTTTAAATTTCATTTTTGGTAGTTAAAGGCCGTGTTTAGTTTCAAAGTTTTTCTTCAAACTTCAAACTTTTCTATCACATCAAAA[C/T]
TTTTCTACACACACAAACTTTCAACTTTTCCGTCACATCGTTCCAATTTCAACCAAATTTCTAATTTTGGCGTGAACTAAACACAGCCAAAATTATGAAA

Reverse complement sequence

TTTCATAATTTTGGCTGTGTTTAGTTCACGCCAAAATTAGAAATTTGGTTGAAATTGGAACGATGTGACGGAAAAGTTGAAAGTTTGTGTGTGTAGAAAA[G/A]
TTTTGATGTGATAGAAAAGTTTGAAGTTTGAAGAAAAACTTTGAAACTAAACACGGCCTTTAACTACCAAAAATGAAATTTAAAATAATGGACGGCCCTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.70%	1.10%	0.78%	3.45%	NA
All Indica	2759	97.30%	0.00%	0.04%	2.68%	NA
All Japonica	1512	94.30%	3.30%	1.92%	0.46%	NA
Aus	269	98.10%	0.00%	0.00%	1.86%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.90%	0.00%	0.00%	1.08%	NA
Indica III	913	96.20%	0.00%	0.00%	3.83%	NA
Indica Intermediate	786	95.50%	0.00%	0.13%	4.33%	NA
Temperate Japonica	767	93.40%	3.10%	3.52%	0.00%	NA
Tropical Japonica	504	95.00%	4.60%	0.20%	0.20%	NA
Japonica Intermediate	241	95.90%	1.20%	0.41%	2.49%	NA
VI/Aromatic	96	21.90%	0.00%	4.17%	73.96%	NA
Intermediate	90	88.90%	1.10%	3.33%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0202518756	C -> T	LOC_Os02g05244.1	3_prime_UTR_variant ; 1448.0bp to feature; MODIFIER	silent_mutation	Average:51.373; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0202518756	C -> T	LOC_Os02g05250.1	downstream_gene_variant ; 2468.0bp to feature; MODIFIER	silent_mutation	Average:51.373; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0202518756	C -> T	LOC_Os02g05244.2	intron_variant ; MODIFIER	silent_mutation	Average:51.373; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0202518756	C -> DEL	N	N	silent_mutation	Average:51.373; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0202518756	NA	4.85E-06	mr1071	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202518756	4.69E-08	9.22E-08	mr1078	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202518756	NA	2.17E-06	mr1080	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202518756	2.60E-07	4.09E-07	mr1100	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202518756	1.67E-06	1.67E-06	mr1141	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202518756	NA	6.78E-06	mr1395	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202518756	5.30E-06	NA	mr1517	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202518756	2.40E-07	2.11E-07	mr1613	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202518756	4.58E-07	1.39E-07	mr1619	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202518756	2.84E-07	2.84E-07	mr1795	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202518756	1.42E-08	1.40E-08	mr1962	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202518756	1.22E-06	1.49E-06	mr1982	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251