\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0202518756:

Variant ID: vg0202518756 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 2518756
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGGGCCGTCCATTATTTTAAATTTCATTTTTGGTAGTTAAAGGCCGTGTTTAGTTTCAAAGTTTTTCTTCAAACTTCAAACTTTTCTATCACATCAAAA[C/T]
TTTTCTACACACACAAACTTTCAACTTTTCCGTCACATCGTTCCAATTTCAACCAAATTTCTAATTTTGGCGTGAACTAAACACAGCCAAAATTATGAAA

Reverse complement sequence

TTTCATAATTTTGGCTGTGTTTAGTTCACGCCAAAATTAGAAATTTGGTTGAAATTGGAACGATGTGACGGAAAAGTTGAAAGTTTGTGTGTGTAGAAAA[G/A]
TTTTGATGTGATAGAAAAGTTTGAAGTTTGAAGAAAAACTTTGAAACTAAACACGGCCTTTAACTACCAAAAATGAAATTTAAAATAATGGACGGCCCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.70% 1.10% 0.78% 3.45% NA
All Indica  2759 97.30% 0.00% 0.04% 2.68% NA
All Japonica  1512 94.30% 3.30% 1.92% 0.46% NA
Aus  269 98.10% 0.00% 0.00% 1.86% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.90% 0.00% 0.00% 1.08% NA
Indica III  913 96.20% 0.00% 0.00% 3.83% NA
Indica Intermediate  786 95.50% 0.00% 0.13% 4.33% NA
Temperate Japonica  767 93.40% 3.10% 3.52% 0.00% NA
Tropical Japonica  504 95.00% 4.60% 0.20% 0.20% NA
Japonica Intermediate  241 95.90% 1.20% 0.41% 2.49% NA
VI/Aromatic  96 21.90% 0.00% 4.17% 73.96% NA
Intermediate  90 88.90% 1.10% 3.33% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0202518756 C -> T LOC_Os02g05244.1 3_prime_UTR_variant ; 1448.0bp to feature; MODIFIER silent_mutation Average:51.373; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0202518756 C -> T LOC_Os02g05250.1 downstream_gene_variant ; 2468.0bp to feature; MODIFIER silent_mutation Average:51.373; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0202518756 C -> T LOC_Os02g05244.2 intron_variant ; MODIFIER silent_mutation Average:51.373; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0202518756 C -> DEL N N silent_mutation Average:51.373; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0202518756 NA 4.85E-06 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202518756 4.69E-08 9.22E-08 mr1078 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202518756 NA 2.17E-06 mr1080 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202518756 2.60E-07 4.09E-07 mr1100 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202518756 1.67E-06 1.67E-06 mr1141 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202518756 NA 6.78E-06 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202518756 5.30E-06 NA mr1517 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202518756 2.40E-07 2.11E-07 mr1613 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202518756 4.58E-07 1.39E-07 mr1619 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202518756 2.84E-07 2.84E-07 mr1795 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202518756 1.42E-08 1.40E-08 mr1962 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202518756 1.22E-06 1.49E-06 mr1982 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251