\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0202488595:

Variant ID: vg0202488595 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 2488595
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


GGGGTTGATGAGGTGATGGACAACAGTGCAGGATCAACAATGAGAACAGGATGGAGCGGAGAGATGGATCAGTAGTTCCTCCAATCTACAAGTGCATACT[A/G]
TACCGAACGCCACACATGATCTCCGTTTAGGATCCTCAGTAGTGGTATGTCTAACATGATGTGGTGATCTTTGTGGAACAGGCATAGGTTTGTGTCTTAG

Reverse complement sequence

CTAAGACACAAACCTATGCCTGTTCCACAAAGATCACCACATCATGTTAGACATACCACTACTGAGGATCCTAAACGGAGATCATGTGTGGCGTTCGGTA[T/C]
AGTATGCACTTGTAGATTGGAGGAACTACTGATCCATCTCTCCGCTCCATCCTGTTCTCATTGTTGATCCTGCACTGTTGTCCATCACCTCATCAACCCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.50% 22.50% 2.03% 3.91% NA
All Indica  2759 75.40% 20.00% 1.59% 2.97% NA
All Japonica  1512 66.90% 29.60% 2.98% 0.46% NA
Aus  269 84.00% 13.00% 0.74% 2.23% NA
Indica I  595 57.80% 36.80% 5.38% 0.00% NA
Indica II  465 82.20% 15.10% 1.51% 1.29% NA
Indica III  913 80.30% 15.20% 0.33% 4.16% NA
Indica Intermediate  786 79.00% 15.90% 0.25% 4.83% NA
Temperate Japonica  767 97.70% 1.20% 1.17% 0.00% NA
Tropical Japonica  504 15.90% 79.00% 4.96% 0.20% NA
Japonica Intermediate  241 75.90% 17.00% 4.56% 2.49% NA
VI/Aromatic  96 8.30% 4.20% 0.00% 87.50% NA
Intermediate  90 60.00% 27.80% 5.56% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0202488595 A -> G LOC_Os02g05199.1 3_prime_UTR_variant ; 994.0bp to feature; MODIFIER silent_mutation Average:56.601; most accessible tissue: Zhenshan97 flower, score: 75.657 N N N N
vg0202488595 A -> G LOC_Os02g05199.6 3_prime_UTR_variant ; 994.0bp to feature; MODIFIER silent_mutation Average:56.601; most accessible tissue: Zhenshan97 flower, score: 75.657 N N N N
vg0202488595 A -> G LOC_Os02g05199.2 3_prime_UTR_variant ; 994.0bp to feature; MODIFIER silent_mutation Average:56.601; most accessible tissue: Zhenshan97 flower, score: 75.657 N N N N
vg0202488595 A -> G LOC_Os02g05199.3 3_prime_UTR_variant ; 994.0bp to feature; MODIFIER silent_mutation Average:56.601; most accessible tissue: Zhenshan97 flower, score: 75.657 N N N N
vg0202488595 A -> G LOC_Os02g05199.4 3_prime_UTR_variant ; 994.0bp to feature; MODIFIER silent_mutation Average:56.601; most accessible tissue: Zhenshan97 flower, score: 75.657 N N N N
vg0202488595 A -> G LOC_Os02g05199.5 3_prime_UTR_variant ; 994.0bp to feature; MODIFIER silent_mutation Average:56.601; most accessible tissue: Zhenshan97 flower, score: 75.657 N N N N
vg0202488595 A -> G LOC_Os02g05190.1 downstream_gene_variant ; 3329.0bp to feature; MODIFIER silent_mutation Average:56.601; most accessible tissue: Zhenshan97 flower, score: 75.657 N N N N
vg0202488595 A -> G LOC_Os02g05210.1 downstream_gene_variant ; 2087.0bp to feature; MODIFIER silent_mutation Average:56.601; most accessible tissue: Zhenshan97 flower, score: 75.657 N N N N
vg0202488595 A -> DEL N N silent_mutation Average:56.601; most accessible tissue: Zhenshan97 flower, score: 75.657 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0202488595 NA 1.64E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202488595 NA 9.76E-08 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202488595 NA 2.20E-06 mr1826 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202488595 NA 8.12E-08 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202488595 NA 9.13E-07 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202488595 NA 6.87E-10 mr1338_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202488595 NA 3.45E-07 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202488595 NA 2.45E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202488595 NA 9.22E-07 mr1383_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202488595 NA 2.37E-07 mr1425_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202488595 NA 2.26E-12 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202488595 NA 1.92E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202488595 NA 2.91E-11 mr1552_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202488595 NA 1.09E-13 mr1732_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202488595 NA 5.46E-09 mr1879_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251