\
| Variant ID: vg0202488595 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 2488595 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 263. )
GGGGTTGATGAGGTGATGGACAACAGTGCAGGATCAACAATGAGAACAGGATGGAGCGGAGAGATGGATCAGTAGTTCCTCCAATCTACAAGTGCATACT[A/G]
TACCGAACGCCACACATGATCTCCGTTTAGGATCCTCAGTAGTGGTATGTCTAACATGATGTGGTGATCTTTGTGGAACAGGCATAGGTTTGTGTCTTAG
CTAAGACACAAACCTATGCCTGTTCCACAAAGATCACCACATCATGTTAGACATACCACTACTGAGGATCCTAAACGGAGATCATGTGTGGCGTTCGGTA[T/C]
AGTATGCACTTGTAGATTGGAGGAACTACTGATCCATCTCTCCGCTCCATCCTGTTCTCATTGTTGATCCTGCACTGTTGTCCATCACCTCATCAACCCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.50% | 22.50% | 2.03% | 3.91% | NA |
| All Indica | 2759 | 75.40% | 20.00% | 1.59% | 2.97% | NA |
| All Japonica | 1512 | 66.90% | 29.60% | 2.98% | 0.46% | NA |
| Aus | 269 | 84.00% | 13.00% | 0.74% | 2.23% | NA |
| Indica I | 595 | 57.80% | 36.80% | 5.38% | 0.00% | NA |
| Indica II | 465 | 82.20% | 15.10% | 1.51% | 1.29% | NA |
| Indica III | 913 | 80.30% | 15.20% | 0.33% | 4.16% | NA |
| Indica Intermediate | 786 | 79.00% | 15.90% | 0.25% | 4.83% | NA |
| Temperate Japonica | 767 | 97.70% | 1.20% | 1.17% | 0.00% | NA |
| Tropical Japonica | 504 | 15.90% | 79.00% | 4.96% | 0.20% | NA |
| Japonica Intermediate | 241 | 75.90% | 17.00% | 4.56% | 2.49% | NA |
| VI/Aromatic | 96 | 8.30% | 4.20% | 0.00% | 87.50% | NA |
| Intermediate | 90 | 60.00% | 27.80% | 5.56% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0202488595 | A -> G | LOC_Os02g05199.1 | 3_prime_UTR_variant ; 994.0bp to feature; MODIFIER | silent_mutation | Average:56.601; most accessible tissue: Zhenshan97 flower, score: 75.657 | N | N | N | N |
| vg0202488595 | A -> G | LOC_Os02g05199.6 | 3_prime_UTR_variant ; 994.0bp to feature; MODIFIER | silent_mutation | Average:56.601; most accessible tissue: Zhenshan97 flower, score: 75.657 | N | N | N | N |
| vg0202488595 | A -> G | LOC_Os02g05199.2 | 3_prime_UTR_variant ; 994.0bp to feature; MODIFIER | silent_mutation | Average:56.601; most accessible tissue: Zhenshan97 flower, score: 75.657 | N | N | N | N |
| vg0202488595 | A -> G | LOC_Os02g05199.3 | 3_prime_UTR_variant ; 994.0bp to feature; MODIFIER | silent_mutation | Average:56.601; most accessible tissue: Zhenshan97 flower, score: 75.657 | N | N | N | N |
| vg0202488595 | A -> G | LOC_Os02g05199.4 | 3_prime_UTR_variant ; 994.0bp to feature; MODIFIER | silent_mutation | Average:56.601; most accessible tissue: Zhenshan97 flower, score: 75.657 | N | N | N | N |
| vg0202488595 | A -> G | LOC_Os02g05199.5 | 3_prime_UTR_variant ; 994.0bp to feature; MODIFIER | silent_mutation | Average:56.601; most accessible tissue: Zhenshan97 flower, score: 75.657 | N | N | N | N |
| vg0202488595 | A -> G | LOC_Os02g05190.1 | downstream_gene_variant ; 3329.0bp to feature; MODIFIER | silent_mutation | Average:56.601; most accessible tissue: Zhenshan97 flower, score: 75.657 | N | N | N | N |
| vg0202488595 | A -> G | LOC_Os02g05210.1 | downstream_gene_variant ; 2087.0bp to feature; MODIFIER | silent_mutation | Average:56.601; most accessible tissue: Zhenshan97 flower, score: 75.657 | N | N | N | N |
| vg0202488595 | A -> DEL | N | N | silent_mutation | Average:56.601; most accessible tissue: Zhenshan97 flower, score: 75.657 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0202488595 | NA | 1.64E-06 | mr1530 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202488595 | NA | 9.76E-08 | mr1739 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202488595 | NA | 2.20E-06 | mr1826 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202488595 | NA | 8.12E-08 | mr1156_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202488595 | NA | 9.13E-07 | mr1277_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202488595 | NA | 6.87E-10 | mr1338_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202488595 | NA | 3.45E-07 | mr1347_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202488595 | NA | 2.45E-06 | mr1363_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202488595 | NA | 9.22E-07 | mr1383_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202488595 | NA | 2.37E-07 | mr1425_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202488595 | NA | 2.26E-12 | mr1530_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202488595 | NA | 1.92E-07 | mr1551_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202488595 | NA | 2.91E-11 | mr1552_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202488595 | NA | 1.09E-13 | mr1732_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202488595 | NA | 5.46E-09 | mr1879_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |