Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0202453103:

Variant ID: vg0202453103 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 2453103
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAGTGGATGGATGCAGAGACAAAGGATTTAGACAGGTTCAGGCCCTCTCAATGAGAGGTAATACCCTACTCCTGTTTGGGGATTTGAATCCGCCGGGT[A/G]
TGTATTGATCTGACGATCAGGTTGTGTCATCTATGCCCCCTAGAGGGCCTCCTGCCCACCTTATATAGGATGGGGGGCAGGATTACAAGATAGAAACCTT

Reverse complement sequence

AAGGTTTCTATCTTGTAATCCTGCCCCCCATCCTATATAAGGTGGGCAGGAGGCCCTCTAGGGGGCATAGATGACACAACCTGATCGTCAGATCAATACA[T/C]
ACCCGGCGGATTCAAATCCCCAAACAGGAGTAGGGTATTACCTCTCATTGAGAGGGCCTGAACCTGTCTAAATCCTTTGTCTCTGCATCCATCCACTTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	11.00%	7.30%	9.23%	72.56%	NA
All Indica	2759	0.70%	0.40%	10.62%	88.29%	NA
All Japonica	1512	31.90%	21.00%	7.47%	39.62%	NA
Aus	269	0.00%	3.70%	5.20%	91.08%	NA
Indica I	595	0.50%	0.20%	6.55%	92.77%	NA
Indica II	465	1.50%	0.40%	4.73%	93.33%	NA
Indica III	913	0.20%	0.40%	16.76%	82.58%	NA
Indica Intermediate	786	1.00%	0.40%	10.05%	88.55%	NA
Temperate Japonica	767	55.40%	28.90%	7.43%	8.21%	NA
Tropical Japonica	504	4.60%	6.00%	4.76%	84.72%	NA
Japonica Intermediate	241	14.10%	27.40%	13.28%	45.23%	NA
VI/Aromatic	96	0.00%	0.00%	8.33%	91.67%	NA
Intermediate	90	17.80%	5.60%	8.89%	67.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0202453103	A -> G	LOC_Os02g05130.1	downstream_gene_variant ; 514.0bp to feature; MODIFIER	silent_mutation	Average:12.764; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg0202453103	A -> G	LOC_Os02g05130-LOC_Os02g05140	intergenic_region ; MODIFIER	silent_mutation	Average:12.764; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg0202453103	A -> DEL	N	N	silent_mutation	Average:12.764; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0202453103	NA	8.10E-08	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202453103	NA	2.47E-06	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202453103	NA	3.23E-06	mr1409_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202453103	NA	6.59E-08	mr1606_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202453103	NA	4.34E-09	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202453103	NA	3.96E-10	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202453103	NA	9.17E-06	mr1765_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202453103	NA	3.02E-09	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251