\
| Variant ID: vg0202377139 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 2377139 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 124. )
CAATTAATAAAAAAAAGAATTTTGGAATTAAAAAATATTATAAGTAGAGTATAGAGTCCATAAAGGAATTTAAAACTAACTAAAATTCGAAATAAACATA[G/A]
TAAAATCAAAAGTAGAGTTTAGAGTCCGTATAAAAATACAATTTACAAACAACTAAAATTCGAAATTAAGAAAAACATGGGAAGAAGAGTTTAAAGTCAA
TTGACTTTAAACTCTTCTTCCCATGTTTTTCTTAATTTCGAATTTTAGTTGTTTGTAAATTGTATTTTTATACGGACTCTAAACTCTACTTTTGATTTTA[C/T]
TATGTTTATTTCGAATTTTAGTTAGTTTTAAATTCCTTTATGGACTCTATACTCTACTTATAATATTTTTTAATTCCAAAATTCTTTTTTTTATTAATTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.90% | 7.90% | 13.92% | 8.32% | NA |
| All Indica | 2759 | 75.20% | 0.30% | 14.06% | 10.40% | NA |
| All Japonica | 1512 | 63.00% | 23.10% | 10.19% | 3.70% | NA |
| Aus | 269 | 43.90% | 0.00% | 39.03% | 17.10% | NA |
| Indica I | 595 | 69.10% | 0.00% | 17.98% | 12.94% | NA |
| Indica II | 465 | 73.30% | 0.60% | 14.41% | 11.61% | NA |
| Indica III | 913 | 80.10% | 0.10% | 11.17% | 8.65% | NA |
| Indica Intermediate | 786 | 75.40% | 0.50% | 14.25% | 9.80% | NA |
| Temperate Japonica | 767 | 38.10% | 39.50% | 17.21% | 5.22% | NA |
| Tropical Japonica | 504 | 93.30% | 3.20% | 2.18% | 1.39% | NA |
| Japonica Intermediate | 241 | 79.30% | 12.40% | 4.56% | 3.73% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 16.70% | 10.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0202377139 | G -> A | LOC_Os02g05020.1 | upstream_gene_variant ; 2759.0bp to feature; MODIFIER | silent_mutation | Average:14.315; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| vg0202377139 | G -> A | LOC_Os02g05000-LOC_Os02g05020 | intergenic_region ; MODIFIER | silent_mutation | Average:14.315; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| vg0202377139 | G -> DEL | N | N | silent_mutation | Average:14.315; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0202377139 | NA | 4.37E-12 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0202377139 | NA | 1.28E-11 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202377139 | NA | 5.44E-07 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202377139 | NA | 1.49E-06 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202377139 | NA | 2.41E-13 | mr1182_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202377139 | NA | 5.48E-07 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202377139 | NA | 1.07E-07 | mr1330_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202377139 | NA | 1.18E-07 | mr1446_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202377139 | NA | 8.76E-09 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202377139 | NA | 1.20E-06 | mr1627_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202377139 | 4.63E-06 | NA | mr1712_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202377139 | NA | 3.77E-09 | mr1946_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202377139 | NA | 3.77E-09 | mr1948_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202377139 | NA | 3.26E-08 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |