Variant ID: vg0202310606 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 2310606 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 322. )
AGAGATAGCTGTCTGTTTCTTTGACTTCCAAGCAAGAAGAGAAGATCCCAGGAAGATACAATAGCCAGTAATAGAGCATCGATCAATAGGGTCACTTGCC[C/T]
AAGTGGAATCTGAATAAGCTTGAAGCTCTAATGAGCTATCACGGGAGAAAAATATACCACGAGATGGCGTCCCACGTAGATAGCGGAGCACTCGTAATAG
CTATTACGAGTGCTCCGCTATCTACGTGGGACGCCATCTCGTGGTATATTTTTCTCCCGTGATAGCTCATTAGAGCTTCAAGCTTATTCAGATTCCACTT[G/A]
GGCAAGTGACCCTATTGATCGATGCTCTATTACTGGCTATTGTATCTTCCTGGGATCTTCTCTTCTTGCTTGGAAGTCAAAGAAACAGACAGCTATCTCT
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 66.30% | 0.40% | 3.07% | 30.19% | NA |
All Indica | 2759 | 65.40% | 0.00% | 2.61% | 31.97% | NA |
All Japonica | 1512 | 60.80% | 1.20% | 3.97% | 34.06% | NA |
Aus | 269 | 89.60% | 0.00% | 4.46% | 5.95% | NA |
Indica I | 595 | 61.20% | 0.00% | 3.70% | 35.13% | NA |
Indica II | 465 | 64.30% | 0.00% | 2.80% | 32.90% | NA |
Indica III | 913 | 69.10% | 0.00% | 1.75% | 29.13% | NA |
Indica Intermediate | 786 | 64.90% | 0.10% | 2.67% | 32.32% | NA |
Temperate Japonica | 767 | 90.60% | 0.70% | 0.26% | 8.47% | NA |
Tropical Japonica | 504 | 20.00% | 2.20% | 9.52% | 68.25% | NA |
Japonica Intermediate | 241 | 51.00% | 0.80% | 4.15% | 43.98% | NA |
VI/Aromatic | 96 | 91.70% | 0.00% | 0.00% | 8.33% | NA |
Intermediate | 90 | 91.10% | 1.10% | 1.11% | 6.67% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0202310606 | C -> T | LOC_Os02g04945.1 | downstream_gene_variant ; 1544.0bp to feature; MODIFIER | silent_mutation | Average:17.579; most accessible tissue: Minghui63 root, score: 41.911 | N | N | N | N |
vg0202310606 | C -> T | LOC_Os02g04940-LOC_Os02g04945 | intergenic_region ; MODIFIER | silent_mutation | Average:17.579; most accessible tissue: Minghui63 root, score: 41.911 | N | N | N | N |
vg0202310606 | C -> DEL | N | N | silent_mutation | Average:17.579; most accessible tissue: Minghui63 root, score: 41.911 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0202310606 | 6.35E-09 | 1.44E-12 | Grain_weight | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg0202310606 | NA | 9.38E-06 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0202310606 | NA | 1.48E-06 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0202310606 | NA | 7.82E-07 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0202310606 | NA | 5.19E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0202310606 | NA | 7.54E-10 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |