\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0202261095:

Variant ID: vg0202261095 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 2261095
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTATCGTTTGTGCTTCAAGGTTTTCGTTATAGCAGATTTATATTGAATTATTATTTTATATCACATTATCCAGTGATTCAAATTGATGTACAATTTTT[C/T]
CCGTTGCAACGCACGGACGTCCAGCTAGTAGTGACTAACTGTCGTTCAGATAAGAATTGCATCATCATGAAAGAAATAGTATACAGAGCTTTCGAATGCA

Reverse complement sequence

TGCATTCGAAAGCTCTGTATACTATTTCTTTCATGATGATGCAATTCTTATCTGAACGACAGTTAGTCACTACTAGCTGGACGTCCGTGCGTTGCAACGG[G/A]
AAAAATTGTACATCAATTTGAATCACTGGATAATGTGATATAAAATAATAATTCAATATAAATCTGCTATAACGAAAACCTTGAAGCACAAACGATAATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.40% 12.40% 0.51% 23.64% NA
All Indica  2759 66.90% 0.30% 0.43% 32.37% NA
All Japonica  1512 62.20% 36.80% 0.60% 0.40% NA
Aus  269 21.60% 1.50% 1.12% 75.84% NA
Indica I  595 67.60% 0.30% 0.50% 31.60% NA
Indica II  465 75.30% 0.40% 0.22% 24.09% NA
Indica III  913 57.40% 0.40% 0.44% 41.73% NA
Indica Intermediate  786 72.40% 0.10% 0.51% 26.97% NA
Temperate Japonica  767 76.40% 22.30% 1.17% 0.13% NA
Tropical Japonica  504 36.50% 62.50% 0.00% 0.99% NA
Japonica Intermediate  241 70.50% 29.50% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 66.70% 20.00% 0.00% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0202261095 C -> T LOC_Os02g04880.1 downstream_gene_variant ; 4144.0bp to feature; MODIFIER silent_mutation Average:32.287; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0202261095 C -> T LOC_Os02g04890.1 downstream_gene_variant ; 1106.0bp to feature; MODIFIER silent_mutation Average:32.287; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0202261095 C -> T LOC_Os02g04900.1 downstream_gene_variant ; 2509.0bp to feature; MODIFIER silent_mutation Average:32.287; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0202261095 C -> T LOC_Os02g04890-LOC_Os02g04900 intergenic_region ; MODIFIER silent_mutation Average:32.287; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0202261095 C -> DEL N N silent_mutation Average:32.287; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0202261095 NA 5.74E-06 mr1378 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202261095 NA 1.39E-11 mr1454 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202261095 2.95E-06 NA mr1530 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202261095 NA 4.97E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202261095 NA 3.16E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202261095 NA 4.32E-18 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202261095 NA 2.29E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251