Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0202261095:

Variant ID: vg0202261095 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 2261095
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATTATCGTTTGTGCTTCAAGGTTTTCGTTATAGCAGATTTATATTGAATTATTATTTTATATCACATTATCCAGTGATTCAAATTGATGTACAATTTTT[C/T]
CCGTTGCAACGCACGGACGTCCAGCTAGTAGTGACTAACTGTCGTTCAGATAAGAATTGCATCATCATGAAAGAAATAGTATACAGAGCTTTCGAATGCA

Reverse complement sequence

TGCATTCGAAAGCTCTGTATACTATTTCTTTCATGATGATGCAATTCTTATCTGAACGACAGTTAGTCACTACTAGCTGGACGTCCGTGCGTTGCAACGG[G/A]
AAAAATTGTACATCAATTTGAATCACTGGATAATGTGATATAAAATAATAATTCAATATAAATCTGCTATAACGAAAACCTTGAAGCACAAACGATAATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.40%	12.40%	0.51%	23.64%	NA
All Indica	2759	66.90%	0.30%	0.43%	32.37%	NA
All Japonica	1512	62.20%	36.80%	0.60%	0.40%	NA
Aus	269	21.60%	1.50%	1.12%	75.84%	NA
Indica I	595	67.60%	0.30%	0.50%	31.60%	NA
Indica II	465	75.30%	0.40%	0.22%	24.09%	NA
Indica III	913	57.40%	0.40%	0.44%	41.73%	NA
Indica Intermediate	786	72.40%	0.10%	0.51%	26.97%	NA
Temperate Japonica	767	76.40%	22.30%	1.17%	0.13%	NA
Tropical Japonica	504	36.50%	62.50%	0.00%	0.99%	NA
Japonica Intermediate	241	70.50%	29.50%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	66.70%	20.00%	0.00%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0202261095	C -> T	LOC_Os02g04880.1	downstream_gene_variant ; 4144.0bp to feature; MODIFIER	silent_mutation	Average:32.287; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0202261095	C -> T	LOC_Os02g04890.1	downstream_gene_variant ; 1106.0bp to feature; MODIFIER	silent_mutation	Average:32.287; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0202261095	C -> T	LOC_Os02g04900.1	downstream_gene_variant ; 2509.0bp to feature; MODIFIER	silent_mutation	Average:32.287; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0202261095	C -> T	LOC_Os02g04890-LOC_Os02g04900	intergenic_region ; MODIFIER	silent_mutation	Average:32.287; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0202261095	C -> DEL	N	N	silent_mutation	Average:32.287; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0202261095	NA	5.74E-06	mr1378	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202261095	NA	1.39E-11	mr1454	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202261095	2.95E-06	NA	mr1530	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202261095	NA	4.97E-06	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202261095	NA	3.16E-07	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202261095	NA	4.32E-18	mr1715	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202261095	NA	2.29E-06	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251