\
| Variant ID: vg0202261095 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 2261095 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AATTATCGTTTGTGCTTCAAGGTTTTCGTTATAGCAGATTTATATTGAATTATTATTTTATATCACATTATCCAGTGATTCAAATTGATGTACAATTTTT[C/T]
CCGTTGCAACGCACGGACGTCCAGCTAGTAGTGACTAACTGTCGTTCAGATAAGAATTGCATCATCATGAAAGAAATAGTATACAGAGCTTTCGAATGCA
TGCATTCGAAAGCTCTGTATACTATTTCTTTCATGATGATGCAATTCTTATCTGAACGACAGTTAGTCACTACTAGCTGGACGTCCGTGCGTTGCAACGG[G/A]
AAAAATTGTACATCAATTTGAATCACTGGATAATGTGATATAAAATAATAATTCAATATAAATCTGCTATAACGAAAACCTTGAAGCACAAACGATAATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.40% | 12.40% | 0.51% | 23.64% | NA |
| All Indica | 2759 | 66.90% | 0.30% | 0.43% | 32.37% | NA |
| All Japonica | 1512 | 62.20% | 36.80% | 0.60% | 0.40% | NA |
| Aus | 269 | 21.60% | 1.50% | 1.12% | 75.84% | NA |
| Indica I | 595 | 67.60% | 0.30% | 0.50% | 31.60% | NA |
| Indica II | 465 | 75.30% | 0.40% | 0.22% | 24.09% | NA |
| Indica III | 913 | 57.40% | 0.40% | 0.44% | 41.73% | NA |
| Indica Intermediate | 786 | 72.40% | 0.10% | 0.51% | 26.97% | NA |
| Temperate Japonica | 767 | 76.40% | 22.30% | 1.17% | 0.13% | NA |
| Tropical Japonica | 504 | 36.50% | 62.50% | 0.00% | 0.99% | NA |
| Japonica Intermediate | 241 | 70.50% | 29.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 66.70% | 20.00% | 0.00% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0202261095 | C -> T | LOC_Os02g04880.1 | downstream_gene_variant ; 4144.0bp to feature; MODIFIER | silent_mutation | Average:32.287; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0202261095 | C -> T | LOC_Os02g04890.1 | downstream_gene_variant ; 1106.0bp to feature; MODIFIER | silent_mutation | Average:32.287; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0202261095 | C -> T | LOC_Os02g04900.1 | downstream_gene_variant ; 2509.0bp to feature; MODIFIER | silent_mutation | Average:32.287; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0202261095 | C -> T | LOC_Os02g04890-LOC_Os02g04900 | intergenic_region ; MODIFIER | silent_mutation | Average:32.287; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0202261095 | C -> DEL | N | N | silent_mutation | Average:32.287; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0202261095 | NA | 5.74E-06 | mr1378 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202261095 | NA | 1.39E-11 | mr1454 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202261095 | 2.95E-06 | NA | mr1530 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202261095 | NA | 4.97E-06 | mr1530 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202261095 | NA | 3.16E-07 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202261095 | NA | 4.32E-18 | mr1715 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202261095 | NA | 2.29E-06 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |