\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0202256731:

Variant ID: vg0202256731 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 2256731
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.53, C: 0.47, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


GGGAATTTGGGGATGCTTTGCACTTGCTAAAAAGAAATTGGGAAGGGTCTTGGGCGTGTTTGTAGTTGCGGTGTGTATTTGGACGATTTGGCTCACTAGG[C/T]
GTGTATTTGGACGATTTGGCTTACTAGGAATGACTGGGTTTTTGAAAACATTTTGGTCAAATCTCCTTTGCAGGTGGTGTACAAGGTTGTTGCTATGATG

Reverse complement sequence

CATCATAGCAACAACCTTGTACACCACCTGCAAAGGAGATTTGACCAAAATGTTTTCAAAAACCCAGTCATTCCTAGTAAGCCAAATCGTCCAAATACAC[G/A]
CCTAGTGAGCCAAATCGTCCAAATACACACCGCAACTACAAACACGCCCAAGACCCTTCCCAATTTCTTTTTAGCAAGTGCAAAGCATCCCCAAATTCCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.70% 37.40% 1.27% 23.57% NA
All Indica  2759 59.60% 6.20% 2.07% 32.11% NA
All Japonica  1512 0.70% 98.90% 0.00% 0.40% NA
Aus  269 3.30% 18.60% 0.74% 77.32% NA
Indica I  595 55.80% 10.90% 1.01% 32.27% NA
Indica II  465 73.30% 1.10% 0.65% 24.95% NA
Indica III  913 50.50% 5.90% 3.72% 39.87% NA
Indica Intermediate  786 64.90% 6.10% 1.78% 27.23% NA
Temperate Japonica  767 0.10% 99.70% 0.00% 0.13% NA
Tropical Japonica  504 0.40% 98.60% 0.00% 0.99% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 1.00% 0.00% 2.08% NA
Intermediate  90 28.90% 56.70% 1.11% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0202256731 C -> T LOC_Os02g04890.1 upstream_gene_variant ; 2694.0bp to feature; MODIFIER silent_mutation Average:58.228; most accessible tissue: Zhenshan97 panicle, score: 88.35 N N N N
vg0202256731 C -> T LOC_Os02g04880.1 intron_variant ; MODIFIER silent_mutation Average:58.228; most accessible tissue: Zhenshan97 panicle, score: 88.35 N N N N
vg0202256731 C -> DEL N N silent_mutation Average:58.228; most accessible tissue: Zhenshan97 panicle, score: 88.35 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0202256731 NA 7.38E-06 mr1177 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202256731 5.29E-06 6.93E-11 mr1177 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202256731 NA 1.15E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202256731 NA 9.04E-06 mr1220 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202256731 NA 2.77E-09 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202256731 NA 6.47E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202256731 NA 4.69E-07 mr1735 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202256731 NA 1.36E-06 mr1772 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202256731 NA 5.76E-15 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202256731 NA 6.27E-16 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202256731 NA 2.05E-06 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202256731 NA 8.13E-21 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202256731 NA 2.18E-08 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202256731 NA 1.39E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251