\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0202240863:

Variant ID: vg0202240863 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 2240863
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


CGTCATACTTTAAACTGGAGTGAGCAATAATCAATTCCGTTATCAACTATGCAATTTTAGAAAACTGCAATTTTAATGACAAAACCAACATTAGCGACAT[G/A]
TTTTAGTTTACTACAACAATAGCGTGAGAAATTATCACAAAACTGTAATTTTTACGTTATATGCTGCTACAGTTGTTACCTATATGTACTGTAACAGCAT

Reverse complement sequence

ATGCTGTTACAGTACATATAGGTAACAACTGTAGCAGCATATAACGTAAAAATTACAGTTTTGTGATAATTTCTCACGCTATTGTTGTAGTAAACTAAAA[C/T]
ATGTCGCTAATGTTGGTTTTGTCATTAAAATTGCAGTTTTCTAAAATTGCATAGTTGATAACGGAATTGATTATTGCTCACTCCAGTTTAAAGTATGACG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.00% 29.80% 0.17% 0.00% NA
All Indica  2759 87.50% 12.40% 0.14% 0.00% NA
All Japonica  1512 47.90% 51.90% 0.20% 0.00% NA
Aus  269 8.60% 91.10% 0.37% 0.00% NA
Indica I  595 81.30% 18.50% 0.17% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 84.60% 15.30% 0.11% 0.00% NA
Indica Intermediate  786 89.90% 9.80% 0.25% 0.00% NA
Temperate Japonica  767 77.10% 22.60% 0.39% 0.00% NA
Tropical Japonica  504 9.10% 90.90% 0.00% 0.00% NA
Japonica Intermediate  241 36.10% 63.90% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 61.10% 38.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0202240863 G -> A LOC_Os02g04840.1 upstream_gene_variant ; 1338.0bp to feature; MODIFIER silent_mutation Average:62.931; most accessible tissue: Zhenshan97 root, score: 88.628 N N N N
vg0202240863 G -> A LOC_Os02g04850.1 downstream_gene_variant ; 203.0bp to feature; MODIFIER silent_mutation Average:62.931; most accessible tissue: Zhenshan97 root, score: 88.628 N N N N
vg0202240863 G -> A LOC_Os02g04860.1 downstream_gene_variant ; 2063.0bp to feature; MODIFIER silent_mutation Average:62.931; most accessible tissue: Zhenshan97 root, score: 88.628 N N N N
vg0202240863 G -> A LOC_Os02g04840-LOC_Os02g04850 intergenic_region ; MODIFIER silent_mutation Average:62.931; most accessible tissue: Zhenshan97 root, score: 88.628 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0202240863 G A -0.02 0.0 0.0 -0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0202240863 NA 5.00E-18 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0202240863 NA 3.49E-18 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0202240863 NA 2.40E-13 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0202240863 NA 2.35E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202240863 7.34E-06 NA mr1229 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202240863 NA 3.80E-10 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202240863 NA 4.89E-06 mr1405 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202240863 NA 5.94E-07 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202240863 NA 1.46E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202240863 NA 7.47E-10 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202240863 6.59E-08 2.07E-27 mr1164_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202240863 NA 9.06E-09 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202240863 NA 7.17E-06 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202240863 NA 3.88E-06 mr1380_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202240863 NA 8.42E-06 mr1561_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202240863 NA 2.12E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202240863 NA 3.05E-06 mr1715_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202240863 NA 1.49E-15 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202240863 NA 7.87E-16 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202240863 NA 3.45E-06 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202240863 NA 9.12E-14 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251