Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0202138774:

Variant ID: vg0202138774 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 2138774
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.26, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

GAAATGAAAAGGCAAGTGGATAGATATCTATAATTTAGAAAAGGAGATTTAAATGTTAAAGAGTAGCTATATGTTTTAGGACAATAGATTAATAAAAATA[T/C]
GAGACCGATATTTTCTCGAGATATAATGGGAGGTTTCGTAAGTCTATATTGATGTGGCACAGGTCGTAGTTGTGTGGTGTTCAAAATTTCGGGAAGGCAC

Reverse complement sequence

GTGCCTTCCCGAAATTTTGAACACCACACAACTACGACCTGTGCCACATCAATATAGACTTACGAAACCTCCCATTATATCTCGAGAAAATATCGGTCTC[A/G]
TATTTTTATTAATCTATTGTCCTAAAACATATAGCTACTCTTTAACATTTAAATCTCCTTTTCTAAATTATAGATATCTATCCACTTGCCTTTTCATTTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.30%	46.70%	0.00%	0.00%	NA
All Indica	2759	86.00%	14.00%	0.00%	0.00%	NA
All Japonica	1512	0.70%	99.30%	0.00%	0.00%	NA
Aus	269	2.20%	97.80%	0.00%	0.00%	NA
Indica I	595	78.50%	21.50%	0.00%	0.00%	NA
Indica II	465	96.60%	3.40%	0.00%	0.00%	NA
Indica III	913	84.30%	15.70%	0.00%	0.00%	NA
Indica Intermediate	786	87.50%	12.50%	0.00%	0.00%	NA
Temperate Japonica	767	0.10%	99.90%	0.00%	0.00%	NA
Tropical Japonica	504	0.40%	99.60%	0.00%	0.00%	NA
Japonica Intermediate	241	2.90%	97.10%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	37.80%	62.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0202138774	T -> C	LOC_Os02g04710.1	upstream_gene_variant ; 1672.0bp to feature; MODIFIER	silent_mutation	Average:57.884; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0202138774	T -> C	LOC_Os02g04720.1	upstream_gene_variant ; 1917.0bp to feature; MODIFIER	silent_mutation	Average:57.884; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0202138774	T -> C	LOC_Os02g04710.2	upstream_gene_variant ; 2911.0bp to feature; MODIFIER	silent_mutation	Average:57.884; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0202138774	T -> C	LOC_Os02g04725.1	downstream_gene_variant ; 3002.0bp to feature; MODIFIER	silent_mutation	Average:57.884; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0202138774	T -> C	LOC_Os02g04725.3	downstream_gene_variant ; 2863.0bp to feature; MODIFIER	silent_mutation	Average:57.884; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0202138774	T -> C	LOC_Os02g04725.2	downstream_gene_variant ; 2872.0bp to feature; MODIFIER	silent_mutation	Average:57.884; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0202138774	T -> C	LOC_Os02g04710-LOC_Os02g04720	intergenic_region ; MODIFIER	silent_mutation	Average:57.884; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0202138774	NA	1.08E-09	mr1151	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202138774	2.87E-06	1.86E-06	mr1229	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202138774	NA	6.04E-09	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202138774	NA	5.60E-09	mr1260	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202138774	NA	7.76E-16	mr1261	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202138774	3.05E-06	NA	mr1314	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202138774	7.87E-06	7.87E-06	mr1393	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202138774	8.27E-06	NA	mr1433	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202138774	NA	1.24E-06	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202138774	NA	2.51E-29	mr1638	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202138774	NA	1.11E-10	mr1714	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202138774	NA	1.99E-06	mr1743	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202138774	NA	7.41E-14	mr1807	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202138774	NA	5.14E-06	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202138774	NA	1.25E-21	mr1164_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202138774	NA	7.94E-09	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202138774	NA	4.38E-09	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251