Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0202051269:

Variant ID: vg0202051269 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 2051269
Reference Allele: C	Alternative Allele: G,T
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.57, G: 0.42, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

TTTACTGATCAACGAGTTCAACTATAAGCTCGGCTTGCTGTTACTCTAAGCTTTCAATATAAGCTGGGCCTTGTGCCTTTTATCTCAAATTAGAAAGGTA[C/G,T]
CCCGCGTATGATAGATTTTGAAAAGCACTATTTCTCAATAATTTTTCTACATCATAATTTTTCCAAACTATTTATTAGCTTTTAAAATATATGATATTTA

Reverse complement sequence

TAAATATCATATATTTTAAAAGCTAATAAATAGTTTGGAAAAATTATGATGTAGAAAAATTATTGAGAAATAGTGCTTTTCAAAATCTATCATACGCGGG[G/C,A]
TACCTTTCTAATTTGAGATAAAAGGCACAAGGCCCAGCTTATATTGAAAGCTTAGAGTAACAGCAAGCCGAGCTTATAGTTGAACTCGTTGATCAGTAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.50%	18.10%	3.58%	4.78%	T: 0.02%
All Indica	2759	58.60%	30.70%	6.02%	4.64%	T: 0.04%
All Japonica	1512	99.60%	0.00%	0.00%	0.40%	NA
Aus	269	97.00%	0.00%	0.00%	2.97%	NA
Indica I	595	63.70%	24.20%	8.40%	3.70%	NA
Indica II	465	83.90%	14.60%	0.43%	1.08%	NA
Indica III	913	40.90%	47.40%	5.70%	5.91%	T: 0.11%
Indica Intermediate	786	60.30%	25.80%	7.89%	5.98%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.00%	0.20%	NA
Japonica Intermediate	241	97.90%	0.00%	0.00%	2.07%	NA
VI/Aromatic	96	18.80%	1.00%	0.00%	80.21%	NA
Intermediate	90	82.20%	6.70%	3.33%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0202051269	C -> G	LOC_Os02g04580.1	upstream_gene_variant ; 3014.0bp to feature; MODIFIER	silent_mutation	Average:44.478; most accessible tissue: Callus, score: 82.589	N	N	N	N
vg0202051269	C -> G	LOC_Os02g04590.1	downstream_gene_variant ; 909.0bp to feature; MODIFIER	silent_mutation	Average:44.478; most accessible tissue: Callus, score: 82.589	N	N	N	N
vg0202051269	C -> G	LOC_Os02g04580-LOC_Os02g04590	intergenic_region ; MODIFIER	silent_mutation	Average:44.478; most accessible tissue: Callus, score: 82.589	N	N	N	N
vg0202051269	C -> T	LOC_Os02g04580.1	upstream_gene_variant ; 3014.0bp to feature; MODIFIER	silent_mutation	Average:44.478; most accessible tissue: Callus, score: 82.589	N	N	N	N
vg0202051269	C -> T	LOC_Os02g04590.1	downstream_gene_variant ; 909.0bp to feature; MODIFIER	silent_mutation	Average:44.478; most accessible tissue: Callus, score: 82.589	N	N	N	N
vg0202051269	C -> T	LOC_Os02g04580-LOC_Os02g04590	intergenic_region ; MODIFIER	silent_mutation	Average:44.478; most accessible tissue: Callus, score: 82.589	N	N	N	N
vg0202051269	C -> DEL	N	N	silent_mutation	Average:44.478; most accessible tissue: Callus, score: 82.589	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0202051269	NA	8.79E-08	mr1298	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202051269	NA	1.25E-06	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251