\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0201504554:

Variant ID: vg0201504554 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 1504554
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTATACGGCTTGTCCAGACCAGGTCGACAACGAAAAAACAAGTGGTTTATCAGTTTTGCAAACATAATTTAAATAACTATTATTTTATTATTTTATGAC[C/T,A]
AAAAATATTTTACGTCTCAATTTCATGCGGTCTGTCCAGACTGGGTCGACAACGAAATAGCATATGCCTTTTCGGTCGTGCTAACAGAATTTAAATTTCC

Reverse complement sequence

GGAAATTTAAATTCTGTTAGCACGACCGAAAAGGCATATGCTATTTCGTTGTCGACCCAGTCTGGACAGACCGCATGAAATTGAGACGTAAAATATTTTT[G/A,T]
GTCATAAAATAATAAAATAATAGTTATTTAAATTATGTTTGCAAAACTGATAAACCACTTGTTTTTTCGTTGTCGACCTGGTCTGGACAAGCCGTATAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.40% 0.90% 0.55% 0.57% A: 0.61%
All Indica  2759 96.20% 1.40% 0.87% 0.62% A: 0.91%
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 94.80% 0.40% 0.74% 3.35% A: 0.74%
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 97.80% 0.20% 0.43% 1.29% A: 0.22%
Indica III  913 93.10% 3.10% 1.10% 0.88% A: 1.86%
Indica Intermediate  786 95.90% 1.30% 1.53% 0.38% A: 0.89%
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 0.00% A: 1.04%
Intermediate  90 96.70% 1.10% 0.00% 1.11% A: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0201504554 C -> A LOC_Os02g03640.1 upstream_gene_variant ; 2760.0bp to feature; MODIFIER silent_mutation Average:47.761; most accessible tissue: Minghui63 flower, score: 71.461 N N N N
vg0201504554 C -> A LOC_Os02g03630.1 downstream_gene_variant ; 1086.0bp to feature; MODIFIER silent_mutation Average:47.761; most accessible tissue: Minghui63 flower, score: 71.461 N N N N
vg0201504554 C -> A LOC_Os02g03630-LOC_Os02g03640 intergenic_region ; MODIFIER silent_mutation Average:47.761; most accessible tissue: Minghui63 flower, score: 71.461 N N N N
vg0201504554 C -> T LOC_Os02g03640.1 upstream_gene_variant ; 2760.0bp to feature; MODIFIER silent_mutation Average:47.761; most accessible tissue: Minghui63 flower, score: 71.461 N N N N
vg0201504554 C -> T LOC_Os02g03630.1 downstream_gene_variant ; 1086.0bp to feature; MODIFIER silent_mutation Average:47.761; most accessible tissue: Minghui63 flower, score: 71.461 N N N N
vg0201504554 C -> T LOC_Os02g03630-LOC_Os02g03640 intergenic_region ; MODIFIER silent_mutation Average:47.761; most accessible tissue: Minghui63 flower, score: 71.461 N N N N
vg0201504554 C -> DEL N N silent_mutation Average:47.761; most accessible tissue: Minghui63 flower, score: 71.461 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0201504554 2.57E-06 2.57E-06 mr1462 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251