Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0201504554:

Variant ID: vg0201504554 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 1504554
Reference Allele: C	Alternative Allele: T,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTATACGGCTTGTCCAGACCAGGTCGACAACGAAAAAACAAGTGGTTTATCAGTTTTGCAAACATAATTTAAATAACTATTATTTTATTATTTTATGAC[C/T,A]
AAAAATATTTTACGTCTCAATTTCATGCGGTCTGTCCAGACTGGGTCGACAACGAAATAGCATATGCCTTTTCGGTCGTGCTAACAGAATTTAAATTTCC

Reverse complement sequence

GGAAATTTAAATTCTGTTAGCACGACCGAAAAGGCATATGCTATTTCGTTGTCGACCCAGTCTGGACAGACCGCATGAAATTGAGACGTAAAATATTTTT[G/A,T]
GTCATAAAATAATAAAATAATAGTTATTTAAATTATGTTTGCAAAACTGATAAACCACTTGTTTTTTCGTTGTCGACCTGGTCTGGACAAGCCGTATAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.40%	0.90%	0.55%	0.57%	A: 0.61%
All Indica	2759	96.20%	1.40%	0.87%	0.62%	A: 0.91%
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	94.80%	0.40%	0.74%	3.35%	A: 0.74%
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	97.80%	0.20%	0.43%	1.29%	A: 0.22%
Indica III	913	93.10%	3.10%	1.10%	0.88%	A: 1.86%
Indica Intermediate	786	95.90%	1.30%	1.53%	0.38%	A: 0.89%
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	0.00%	A: 1.04%
Intermediate	90	96.70%	1.10%	0.00%	1.11%	A: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0201504554	C -> A	LOC_Os02g03640.1	upstream_gene_variant ; 2760.0bp to feature; MODIFIER	silent_mutation	Average:47.761; most accessible tissue: Minghui63 flower, score: 71.461	N	N	N	N
vg0201504554	C -> A	LOC_Os02g03630.1	downstream_gene_variant ; 1086.0bp to feature; MODIFIER	silent_mutation	Average:47.761; most accessible tissue: Minghui63 flower, score: 71.461	N	N	N	N
vg0201504554	C -> A	LOC_Os02g03630-LOC_Os02g03640	intergenic_region ; MODIFIER	silent_mutation	Average:47.761; most accessible tissue: Minghui63 flower, score: 71.461	N	N	N	N
vg0201504554	C -> T	LOC_Os02g03640.1	upstream_gene_variant ; 2760.0bp to feature; MODIFIER	silent_mutation	Average:47.761; most accessible tissue: Minghui63 flower, score: 71.461	N	N	N	N
vg0201504554	C -> T	LOC_Os02g03630.1	downstream_gene_variant ; 1086.0bp to feature; MODIFIER	silent_mutation	Average:47.761; most accessible tissue: Minghui63 flower, score: 71.461	N	N	N	N
vg0201504554	C -> T	LOC_Os02g03630-LOC_Os02g03640	intergenic_region ; MODIFIER	silent_mutation	Average:47.761; most accessible tissue: Minghui63 flower, score: 71.461	N	N	N	N
vg0201504554	C -> DEL	N	N	silent_mutation	Average:47.761; most accessible tissue: Minghui63 flower, score: 71.461	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0201504554	2.57E-06	2.57E-06	mr1462	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251