Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0201101756:

Variant ID: vg0201101756 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 1101756
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAGTATGTCTACATGGGTATCTATAGCTCTCTAATCCATTGCCTCGTTTTTCTCGTTAGTAGATAGCTTTGCTATCTCTCTTTATTTAATCTCTTTTAA[G/A]
TAGAAAAAAATGCTGACATAGATATCTTGTAGATAGTATATAGATAATCATTGCGGGTGCCCTTAGTACTACTACTGTACTAGTAGATGGCAAAATGGCA

Reverse complement sequence

TGCCATTTTGCCATCTACTAGTACAGTAGTAGTACTAAGGGCACCCGCAATGATTATCTATATACTATCTACAAGATATCTATGTCAGCATTTTTTTCTA[C/T]
TTAAAAGAGATTAAATAAAGAGAGATAGCAAAGCTATCTACTAACGAGAAAAACGAGGCAATGGATTAGAGAGCTATAGATACCCATGTAGACATACTAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.40%	23.30%	0.32%	0.00%	NA
All Indica	2759	61.90%	38.00%	0.11%	0.00%	NA
All Japonica	1512	96.50%	2.70%	0.79%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	9.40%	90.60%	0.00%	0.00%	NA
Indica II	465	68.40%	31.40%	0.22%	0.00%	NA
Indica III	913	92.60%	7.40%	0.00%	0.00%	NA
Indica Intermediate	786	62.10%	37.70%	0.25%	0.00%	NA
Temperate Japonica	767	93.60%	5.00%	1.43%	0.00%	NA
Tropical Japonica	504	99.60%	0.20%	0.20%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0201101756	G -> A	LOC_Os02g02870.1	downstream_gene_variant ; 1209.0bp to feature; MODIFIER	silent_mutation	Average:87.64; most accessible tissue: Zhenshan97 flower, score: 96.199	N	N	N	N
vg0201101756	G -> A	LOC_Os02g02880.1	downstream_gene_variant ; 4486.0bp to feature; MODIFIER	silent_mutation	Average:87.64; most accessible tissue: Zhenshan97 flower, score: 96.199	N	N	N	N
vg0201101756	G -> A	LOC_Os02g02860-LOC_Os02g02870	intergenic_region ; MODIFIER	silent_mutation	Average:87.64; most accessible tissue: Zhenshan97 flower, score: 96.199	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0201101756	G	A	0.02	0.02	0.02	0.02	0.01	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0201101756	NA	4.80E-07	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201101756	NA	3.53E-07	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201101756	NA	9.85E-08	mr1100	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201101756	NA	5.13E-07	mr1124	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201101756	NA	5.43E-06	mr1202	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201101756	NA	1.01E-06	mr1613	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201101756	NA	5.21E-07	mr1717	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201101756	NA	1.26E-06	mr1842	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201101756	NA	2.46E-07	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201101756	NA	2.28E-07	mr1962	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201101756	2.78E-06	2.78E-06	mr1967	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201101756	NA	4.60E-19	mr1531_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201101756	NA	9.81E-07	mr1531_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201101756	NA	7.86E-07	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251