\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0201099179:

Variant ID: vg0201099179 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 1099179
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


ATTATAAGTGCAGTGATAAGTTTCTGTGTCCAACGTTTGACCGTCCGTTTTATTTGAAAAATTTATGAAAGATTTTTAAAGTTAAGTCGCGCATAAAATA[C/T]
TATTCATATTTTATCATCTAAAAATAATAAAAATACTAATCATAAAAATATTTCAAATAATACGGATGGTCAATGTTGGACACTGAAACTCACAACTACG

Reverse complement sequence

CGTAGTTGTGAGTTTCAGTGTCCAACATTGACCATCCGTATTATTTGAAATATTTTTATGATTAGTATTTTTATTATTTTTAGATGATAAAATATGAATA[G/A]
TATTTTATGCGCGACTTAACTTTAAAAATCTTTCATAAATTTTTCAAATAAAACGGACGGTCAAACGTTGGACACAGAAACTTATCACTGCACTTATAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.50% 12.80% 1.71% 0.00% NA
All Indica  2759 92.80% 6.70% 0.51% 0.00% NA
All Japonica  1512 71.30% 24.60% 4.10% 0.00% NA
Aus  269 90.70% 8.60% 0.74% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 76.60% 21.50% 1.94% 0.00% NA
Indica III  913 98.00% 1.90% 0.11% 0.00% NA
Indica Intermediate  786 91.00% 8.50% 0.51% 0.00% NA
Temperate Japonica  767 94.80% 1.20% 4.04% 0.00% NA
Tropical Japonica  504 29.40% 66.10% 4.56% 0.00% NA
Japonica Intermediate  241 84.20% 12.40% 3.32% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 72.20% 24.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0201099179 C -> T LOC_Os02g02860.1 upstream_gene_variant ; 3186.0bp to feature; MODIFIER silent_mutation Average:57.014; most accessible tissue: Zhenshan97 flag leaf, score: 79.006 N N N N
vg0201099179 C -> T LOC_Os02g02870.1 downstream_gene_variant ; 3786.0bp to feature; MODIFIER silent_mutation Average:57.014; most accessible tissue: Zhenshan97 flag leaf, score: 79.006 N N N N
vg0201099179 C -> T LOC_Os02g02860-LOC_Os02g02870 intergenic_region ; MODIFIER silent_mutation Average:57.014; most accessible tissue: Zhenshan97 flag leaf, score: 79.006 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0201099179 NA 6.65E-10 mr1089 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201099179 NA 4.14E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201099179 NA 6.24E-06 mr1378 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201099179 NA 8.49E-06 mr1415 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201099179 NA 9.60E-11 mr1423 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201099179 NA 8.49E-06 mr1567 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201099179 NA 7.21E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201099179 NA 1.94E-13 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201099179 NA 6.06E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201099179 NA 5.64E-06 mr1858 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201099179 NA 5.66E-06 mr1859 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201099179 NA 6.66E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201099179 NA 1.34E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201099179 NA 2.00E-07 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201099179 NA 6.42E-07 mr1928_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251