Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0201096474:

Variant ID: vg0201096474 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 1096474
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.63, T: 0.37, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTAATTCTAATAATCCATAATTAGCACATGTTTATTATAGCATCACATAGACTAATCATAGATTAATTAGGCTCAATAGATTCGTCTCGCGGATTAGT[T/C]
CAGGGTTATGGAATAGGTTTTGTCAATAGTCTACATTTAATACTTCTAATTAGTGTCTAAATATTTTAGTCCCATCTAAACAGCCCCCCAATCCATTAAA

Reverse complement sequence

TTTAATGGATTGGGGGGCTGTTTAGATGGGACTAAAATATTTAGACACTAATTAGAAGTATTAAATGTAGACTATTGACAAAACCTATTCCATAACCCTG[A/G]
ACTAATCCGCGAGACGAATCTATTGAGCCTAATTAATCTATGATTAGTCTATGTGATGCTATAATAAACATGTGCTAATTATGGATTATTAGAATTAAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.10% 48.80% 0.08% 0.00% NA
All Indica  2759 19.10% 80.90% 0.07% 0.00% NA
All Japonica  1512 97.20% 2.80% 0.00% 0.00% NA
Aus  269 95.90% 3.70% 0.37% 0.00% NA
Indica I  595 2.90% 97.00% 0.17% 0.00% NA
Indica II  465 46.90% 53.10% 0.00% 0.00% NA
Indica III  913 11.00% 88.90% 0.11% 0.00% NA
Indica Intermediate  786 24.30% 75.70% 0.00% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 95.20% 4.80% 0.00% 0.00% NA
Japonica Intermediate  241 93.40% 6.60% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 76.70% 22.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0201096474 T -> C LOC_Os02g02860.1 upstream_gene_variant ; 481.0bp to feature; MODIFIER silent_mutation Average:70.235; most accessible tissue: Minghui63 panicle, score: 90.184 N N N N
vg0201096474 T -> C LOC_Os02g02860-LOC_Os02g02870 intergenic_region ; MODIFIER silent_mutation Average:70.235; most accessible tissue: Minghui63 panicle, score: 90.184 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0201096474 T C 0.0 0.01 0.01 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0201096474 NA 3.05E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201096474 NA 1.43E-10 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201096474 NA 5.80E-08 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201096474 NA 4.90E-08 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201096474 NA 1.89E-06 mr1684 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201096474 NA 9.12E-22 mr1698 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201096474 NA 4.52E-07 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201096474 NA 9.25E-07 mr1734 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201096474 NA 1.31E-06 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201096474 NA 9.55E-10 mr1796 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201096474 NA 3.55E-09 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201096474 NA 6.36E-08 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201096474 NA 1.84E-06 mr1291_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201096474 NA 3.45E-09 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201096474 NA 2.30E-06 mr1399_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201096474 NA 6.34E-06 mr1543_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201096474 NA 8.40E-33 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201096474 NA 8.91E-07 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201096474 NA 3.58E-21 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201096474 NA 4.69E-06 mr1892_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251