\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0201027436:

Variant ID: vg0201027436 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 1027436
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


GAATCCACTTCAGCTTTCGTACAGTTATTTAGGCCAAGCAGCTGCAGGGCGGGGTGAGCCCCAGAGAGAACTCTGTTTAAATGAGACTAAAAAAGTCTCT[A/G]
TCATATTAGATGTTTGGACATTAATTATAAATATTAAACGTAGATTATTAAAAAAACCCATTCTATAACCCTGAACTAATTCGCGAGACGAATCTATTGA

Reverse complement sequence

TCAATAGATTCGTCTCGCGAATTAGTTCAGGGTTATAGAATGGGTTTTTTTAATAATCTACGTTTAATATTTATAATTAATGTCCAAACATCTAATATGA[T/C]
AGAGACTTTTTTAGTCTCATTTAAACAGAGTTCTCTCTGGGGCTCACCCCGCCCTGCAGCTGCTTGGCCTAAATAACTGTACGAAAGCTGAAGTGGATTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.90% 22.90% 0.47% 0.76% NA
All Indica  2759 59.30% 38.60% 0.80% 1.27% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.07% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 10.80% 86.20% 1.34% 1.68% NA
Indica II  465 61.70% 35.70% 0.86% 1.72% NA
Indica III  913 89.60% 10.30% 0.00% 0.11% NA
Indica Intermediate  786 59.40% 37.30% 1.27% 2.04% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.00% 0.20% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0201027436 A -> G LOC_Os02g02720.3 upstream_gene_variant ; 2685.0bp to feature; MODIFIER silent_mutation Average:87.241; most accessible tissue: Minghui63 root, score: 95.978 N N N N
vg0201027436 A -> G LOC_Os02g02730.1 upstream_gene_variant ; 2489.0bp to feature; MODIFIER silent_mutation Average:87.241; most accessible tissue: Minghui63 root, score: 95.978 N N N N
vg0201027436 A -> G LOC_Os02g02720.4 upstream_gene_variant ; 2685.0bp to feature; MODIFIER silent_mutation Average:87.241; most accessible tissue: Minghui63 root, score: 95.978 N N N N
vg0201027436 A -> G LOC_Os02g02720.5 upstream_gene_variant ; 2685.0bp to feature; MODIFIER silent_mutation Average:87.241; most accessible tissue: Minghui63 root, score: 95.978 N N N N
vg0201027436 A -> G LOC_Os02g02720.1 upstream_gene_variant ; 2685.0bp to feature; MODIFIER silent_mutation Average:87.241; most accessible tissue: Minghui63 root, score: 95.978 N N N N
vg0201027436 A -> G LOC_Os02g02720.2 upstream_gene_variant ; 2723.0bp to feature; MODIFIER silent_mutation Average:87.241; most accessible tissue: Minghui63 root, score: 95.978 N N N N
vg0201027436 A -> G LOC_Os02g02720-LOC_Os02g02730 intergenic_region ; MODIFIER silent_mutation Average:87.241; most accessible tissue: Minghui63 root, score: 95.978 N N N N
vg0201027436 A -> DEL N N silent_mutation Average:87.241; most accessible tissue: Minghui63 root, score: 95.978 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0201027436 A G -0.01 -0.11 -0.09 0.07 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0201027436 NA 3.50E-06 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201027436 NA 2.94E-27 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201027436 NA 1.18E-08 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201027436 NA 4.51E-07 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201027436 NA 1.22E-19 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201027436 NA 2.43E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201027436 NA 3.42E-07 mr1080 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201027436 NA 2.00E-09 mr1100 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201027436 NA 4.10E-08 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201027436 NA 3.78E-06 mr1140 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201027436 NA 8.29E-07 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201027436 NA 3.99E-06 mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201027436 NA 5.60E-09 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201027436 NA 4.89E-08 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201027436 NA 9.40E-08 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201027436 NA 2.59E-09 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201027436 NA 9.14E-10 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201027436 NA 3.30E-07 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201027436 NA 9.41E-08 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201027436 NA 4.39E-08 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201027436 NA 3.90E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201027436 NA 2.26E-06 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201027436 NA 5.58E-07 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201027436 NA 3.62E-19 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0201027436 NA 4.54E-07 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251