Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0200923972:

Variant ID: vg0200923972 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 923972
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:

CATTTGAGGCCAGTTTGGCAACTGAAAAACTGTATAGAAAGTTATTCTTGTCCTTGATGGTATTTTGAATGGAGGAAATATATACGTCTGTTTGATTAAT[T/C]
TTTTCATGAACTTTCTCTTGTCATGCTTGATGTGTACCTTGTCCCTGAATCTATGTGAGCAGTCAAGTCTTCAACTTTTCTGTCTAAACCATATGAAATC

Reverse complement sequence

GATTTCATATGGTTTAGACAGAAAAGTTGAAGACTTGACTGCTCACATAGATTCAGGGACAAGGTACACATCAAGCATGACAAGAGAAAGTTCATGAAAA[A/G]
ATTAATCAAACAGACGTATATATTTCCTCCATTCAAAATACCATCAAGGACAAGAATAACTTTCTATACAGTTTTTCAGTTGCCAAACTGGCCTCAAATG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.90%	3.90%	1.14%	0.00%	NA
All Indica	2759	99.40%	0.40%	0.18%	0.00%	NA
All Japonica	1512	89.40%	7.90%	2.65%	0.00%	NA
Aus	269	78.80%	19.00%	2.23%	0.00%	NA
Indica I	595	99.00%	0.70%	0.34%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.70%	0.90%	0.38%	0.00%	NA
Temperate Japonica	767	94.80%	1.80%	3.39%	0.00%	NA
Tropical Japonica	504	88.50%	10.90%	0.60%	0.00%	NA
Japonica Intermediate	241	74.30%	21.20%	4.56%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	94.40%	2.20%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0200923972	T -> C	LOC_Os02g02550.1	upstream_gene_variant ; 482.0bp to feature; MODIFIER	silent_mutation	Average:68.754; most accessible tissue: Callus, score: 88.062	N	N	N	N
vg0200923972	T -> C	LOC_Os02g02540.1	downstream_gene_variant ; 2.0bp to feature; MODIFIER	silent_mutation	Average:68.754; most accessible tissue: Callus, score: 88.062	N	N	N	N
vg0200923972	T -> C	LOC_Os02g02560.1	downstream_gene_variant ; 2059.0bp to feature; MODIFIER	silent_mutation	Average:68.754; most accessible tissue: Callus, score: 88.062	N	N	N	N
vg0200923972	T -> C	LOC_Os02g02540-LOC_Os02g02550	intergenic_region ; MODIFIER	silent_mutation	Average:68.754; most accessible tissue: Callus, score: 88.062	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0200923972	NA	1.78E-07	mr1114	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200923972	NA	2.56E-06	mr1116	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200923972	5.66E-06	2.72E-09	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200923972	NA	5.93E-08	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200923972	NA	3.08E-07	mr1119	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200923972	NA	4.34E-06	mr1120	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200923972	3.83E-06	6.99E-09	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200923972	NA	1.41E-06	mr1240	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200923972	2.17E-07	1.34E-10	mr1242	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200923972	9.85E-06	3.92E-08	mr1247	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200923972	NA	1.52E-06	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200923972	NA	1.89E-07	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200923972	NA	3.06E-06	mr1519	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200923972	2.49E-06	2.87E-08	mr1917	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200923972	NA	9.34E-06	mr1080_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200923972	NA	4.38E-06	mr1114_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200923972	NA	9.96E-07	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200923972	NA	7.77E-06	mr1119_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200923972	NA	6.82E-06	mr1123_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200923972	NA	3.29E-06	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200923972	NA	1.45E-06	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200923972	NA	5.92E-06	mr1242_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200923972	NA	5.95E-06	mr1247_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200923972	NA	6.17E-06	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200923972	NA	5.95E-06	mr1519_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251