Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0200846970:

Variant ID: vg0200846970 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 846970
Reference Allele: G	Alternative Allele: T,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:

GTAGGGAAAAAGAAGGAACCATTGTGTTTTGGAAACACTTTGGGCGTTGGGTAAATGGTGTATATGAAAAATGTACACAACATGATGAGGAGAGTATTTT[G/T,A]
TAAAATGTATCGTGGGGATGGCGGGGCTGACAAGTCTTCATACAGGCTGCACATTTTGGATCCAATGATCCACGATCGAATTTACAATTTTCCATGTAGG

Reverse complement sequence

CCTACATGGAAAATTGTAAATTCGATCGTGGATCATTGGATCCAAAATGTGCAGCCTGTATGAAGACTTGTCAGCCCCGCCATCCCCACGATACATTTTA[C/A,T]
AAAATACTCTCCTCATCATGTTGTGTACATTTTTCATATACACCATTTACCCAACGCCCAAAGTGTTTCCAAAACACAATGGTTCCTTCTTTTTCCCTAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.10%	6.50%	0.42%	0.00%	A: 0.04%
All Indica	2759	95.30%	4.50%	0.14%	0.00%	NA
All Japonica	1512	87.50%	11.50%	0.99%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	79.60%	19.80%	0.65%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	95.80%	4.10%	0.13%	0.00%	NA
Temperate Japonica	767	99.60%	0.00%	0.39%	0.00%	NA
Tropical Japonica	504	64.10%	33.70%	2.18%	0.00%	NA
Japonica Intermediate	241	97.90%	1.70%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	6.70%	1.11%	0.00%	A: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0200846970	G -> A	LOC_Os02g02410.1	upstream_gene_variant ; 4298.0bp to feature; MODIFIER	silent_mutation	Average:29.305; most accessible tissue: Callus, score: 56.616	N	N	N	N
vg0200846970	G -> A	LOC_Os02g02410-LOC_Os02g02424	intergenic_region ; MODIFIER	silent_mutation	Average:29.305; most accessible tissue: Callus, score: 56.616	N	N	N	N
vg0200846970	G -> T	LOC_Os02g02410.1	upstream_gene_variant ; 4298.0bp to feature; MODIFIER	silent_mutation	Average:29.305; most accessible tissue: Callus, score: 56.616	N	N	N	N
vg0200846970	G -> T	LOC_Os02g02410-LOC_Os02g02424	intergenic_region ; MODIFIER	silent_mutation	Average:29.305; most accessible tissue: Callus, score: 56.616	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0200846970	NA	1.04E-07	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200846970	NA	1.45E-07	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200846970	NA	6.34E-09	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200846970	NA	7.54E-08	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200846970	NA	1.96E-06	mr1742	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200846970	1.28E-09	1.28E-09	mr1076_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200846970	4.61E-06	1.30E-10	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200846970	4.68E-08	1.45E-11	mr1083_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200846970	1.60E-06	7.64E-06	mr1085_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200846970	1.80E-06	2.53E-07	mr1103_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200846970	1.97E-06	2.34E-07	mr1104_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200846970	NA	1.91E-06	mr1107_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200846970	2.63E-06	2.63E-06	mr1145_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200846970	4.06E-06	NA	mr1155_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200846970	6.63E-06	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200846970	1.20E-07	2.17E-10	mr1226_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200846970	7.92E-08	2.54E-09	mr1408_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200846970	8.52E-06	NA	mr1437_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251