Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0200828346:

Variant ID: vg0200828346 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 828346
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.04, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

TAAAAGAATTTAATGGTGATGGTGAATCTACCATCATTTAGAGTTGGTGAGATCTTCTAATGCTACATAAATACATCTTTGTGTGTGGTTTGGTTTTCTA[T/C]
TGGATGTTTGATTGCAATTATGTTTGACAAATACAATTTCTAAATCAAGAAATTCACATAAATCTTTTAAAATCCGTCCGTTGCAGAGCACGTTACTTTG

Reverse complement sequence

CAAAGTAACGTGCTCTGCAACGGACGGATTTTAAAAGATTTATGTGAATTTCTTGATTTAGAAATTGTATTTGTCAAACATAATTGCAATCAAACATCCA[A/G]
TAGAAAACCAAACCACACACAAAGATGTATTTATGTAGCATTAGAAGATCTCACCAACTCTAAATGATGGTAGATTCACCATCACCATTAAATTCTTTTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.10%	40.80%	0.11%	0.00%	NA
All Indica	2759	31.40%	68.50%	0.18%	0.00%	NA
All Japonica	1512	98.60%	1.40%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	4.50%	95.30%	0.17%	0.00%	NA
Indica II	465	54.00%	45.80%	0.22%	0.00%	NA
Indica III	913	37.60%	62.20%	0.22%	0.00%	NA
Indica Intermediate	786	31.00%	68.80%	0.13%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	97.40%	2.60%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	17.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0200828346	T -> C	LOC_Os02g02400.1	upstream_gene_variant ; 702.0bp to feature; MODIFIER	silent_mutation	Average:73.464; most accessible tissue: Minghui63 flower, score: 87.676	N	N	N	N
vg0200828346	T -> C	LOC_Os02g02400.2	upstream_gene_variant ; 702.0bp to feature; MODIFIER	silent_mutation	Average:73.464; most accessible tissue: Minghui63 flower, score: 87.676	N	N	N	N
vg0200828346	T -> C	LOC_Os02g02400.3	upstream_gene_variant ; 702.0bp to feature; MODIFIER	silent_mutation	Average:73.464; most accessible tissue: Minghui63 flower, score: 87.676	N	N	N	N
vg0200828346	T -> C	LOC_Os02g02390.1	downstream_gene_variant ; 3800.0bp to feature; MODIFIER	silent_mutation	Average:73.464; most accessible tissue: Minghui63 flower, score: 87.676	N	N	N	N
vg0200828346	T -> C	LOC_Os02g02400-LOC_Os02g02410	intergenic_region ; MODIFIER	silent_mutation	Average:73.464; most accessible tissue: Minghui63 flower, score: 87.676	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0200828346	NA	1.34E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200828346	NA	3.46E-06	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200828346	NA	9.96E-06	mr1684	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200828346	NA	2.13E-07	mr1707	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200828346	NA	5.18E-12	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200828346	NA	6.03E-07	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200828346	NA	3.06E-08	mr1860	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200828346	NA	3.73E-06	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200828346	NA	2.03E-06	mr1042_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200828346	NA	5.25E-06	mr1269_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200828346	NA	1.05E-10	mr1399_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200828346	NA	8.97E-08	mr1399_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200828346	NA	3.53E-07	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200828346	NA	2.39E-07	mr1677_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200828346	NA	2.88E-07	mr1805_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200828346	NA	1.48E-08	mr1860_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200828346	NA	8.42E-06	mr1892_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200828346	NA	5.74E-06	mr1910_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251