\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0200806828:

Variant ID: vg0200806828 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 806828
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTAATTATTAATTATTTTCCTATCATTTGATTCATTGTTAAATATATTTTTATGTAGGCATATAATTTTACATATTTCACAAAAGTTTTTGAATAAGAC[G/A]
AACGGTCAAATATGTGCTAAAAAATAAACGGTGTCAAACATTTCAAAACGGAGGGAGTAGTAGTTTAAGGAGAGTAGCTATTTGCATGCTCTCATGTATA

Reverse complement sequence

TATACATGAGAGCATGCAAATAGCTACTCTCCTTAAACTACTACTCCCTCCGTTTTGAAATGTTTGACACCGTTTATTTTTTAGCACATATTTGACCGTT[C/T]
GTCTTATTCAAAAACTTTTGTGAAATATGTAAAATTATATGCCTACATAAAAATATATTTAACAATGAATCAAATGATAGGAAAATAATTAATAATTACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.80% 6.20% 3.41% 1.59% NA
All Indica  2759 84.40% 10.40% 3.15% 2.03% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 66.50% 0.00% 26.39% 7.06% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 71.40% 21.70% 3.87% 3.01% NA
Indica III  913 83.00% 9.90% 4.38% 2.74% NA
Indica Intermediate  786 81.90% 12.20% 3.69% 2.16% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 6.70% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0200806828 G -> A LOC_Os02g02380-LOC_Os02g02390 intergenic_region ; MODIFIER silent_mutation Average:73.999; most accessible tissue: Zhenshan97 flag leaf, score: 87.087 N N N N
vg0200806828 G -> DEL N N silent_mutation Average:73.999; most accessible tissue: Zhenshan97 flag leaf, score: 87.087 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0200806828 G A -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0200806828 NA 7.25E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200806828 NA 1.60E-06 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200806828 NA 5.29E-06 mr1677 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200806828 NA 6.78E-07 mr1678 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200806828 NA 2.08E-06 mr1698 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200806828 NA 3.82E-06 mr1975 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251