\
| Variant ID: vg0200805186 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 805186 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AATATAAAAAATGAAAAGTTGTACTTAAAGTACTTTGGATAATAAAGTAAGTCACAAATAAAATAAATAATAATTTTAATTTTTTTTAATAAGACGAATG[G/A]
TCAAATAGTGCAAGAAAAAGTCAAAATCCCCTATATTATGGGACGGAGGGAGTACGTACTTCGTTCGTCTCAAAATATAAACAATTTTAACGGAATAAAA
TTTTATTCCGTTAAAATTGTTTATATTTTGAGACGAACGAAGTACGTACTCCCTCCGTCCCATAATATAGGGGATTTTGACTTTTTCTTGCACTATTTGA[C/T]
CATTCGTCTTATTAAAAAAAATTAAAATTATTATTTATTTTATTTGTGACTTACTTTATTATCCAAAGTACTTTAAGTACAACTTTTCATTTTTTATATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.60% | 7.40% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 87.50% | 12.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 80.80% | 19.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 88.20% | 11.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 89.80% | 10.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0200805186 | G -> A | LOC_Os02g02380-LOC_Os02g02390 | intergenic_region ; MODIFIER | silent_mutation | Average:79.366; most accessible tissue: Minghui63 flag leaf, score: 91.625 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0200805186 | NA | 6.41E-06 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200805186 | NA | 2.37E-07 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200805186 | NA | 4.51E-06 | mr1479 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200805186 | NA | 9.45E-06 | mr1479 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200805186 | NA | 2.22E-07 | mr1625 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200805186 | NA | 7.37E-06 | mr1625 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200805186 | NA | 1.85E-06 | mr1678 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200805186 | NA | 8.58E-06 | mr1678 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200805186 | 8.69E-06 | 2.05E-07 | mr1725 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200805186 | NA | 2.69E-06 | mr1725 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200805186 | NA | 2.21E-07 | mr1796 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200805186 | NA | 4.93E-06 | mr1975 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200805186 | NA | 6.51E-07 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |