\
| Variant ID: vg0200800465 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 800465 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 227. )
TAAAGATGAATATCTTTAGTCCCGGATCCGTACTCCCGGTTGGAAAACCGGGATTAAAGGGGGTTCCCAACCGGGAGTAAAGATGGTTTCTCCACCAGTG[A/G]
CATGTGCATGCAGTGCAGTGTGATACCGAAACCTTTTTTCAGGAAAATGTGTAGTTTTCATGAATAAATCTCAGATGTATATTTTTTTATTTAATGGTAG
CTACCATTAAATAAAAAAATATACATCTGAGATTTATTCATGAAAACTACACATTTTCCTGAAAAAAGGTTTCGGTATCACACTGCACTGCATGCACATG[T/C]
CACTGGTGGAGAAACCATCTTTACTCCCGGTTGGGAACCCCCTTTAATCCCGGTTTTCCAACCGGGAGTACGGATCCGGGACTAAAGATATTCATCTTTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.40% | 38.50% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 93.50% | 6.50% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 6.00% | 94.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 68.40% | 31.20% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.50% | 1.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 78.50% | 21.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 10.70% | 89.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 13.30% | 86.30% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 15.60% | 84.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 36.70% | 61.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0200800465 | A -> G | LOC_Os02g02380.1 | upstream_gene_variant ; 4185.0bp to feature; MODIFIER | silent_mutation | Average:50.513; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0200800465 | A -> G | LOC_Os02g02380-LOC_Os02g02390 | intergenic_region ; MODIFIER | silent_mutation | Average:50.513; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0200800465 | NA | 8.17E-07 | mr1278 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200800465 | NA | 1.36E-10 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200800465 | NA | 4.30E-06 | mr1450 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200800465 | NA | 3.57E-29 | mr1638 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200800465 | NA | 2.61E-12 | mr1667 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200800465 | 2.61E-07 | 2.92E-11 | mr1680 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200800465 | NA | 1.20E-23 | mr1698 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200800465 | NA | 2.89E-12 | mr1744 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200800465 | NA | 1.60E-06 | mr1796 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200800465 | NA | 3.62E-06 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200800465 | NA | 2.94E-06 | mr1042_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200800465 | NA | 9.64E-06 | mr1269_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200800465 | NA | 3.44E-07 | mr1568_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200800465 | NA | 2.98E-10 | mr1756_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200800465 | NA | 1.17E-06 | mr1871_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200800465 | NA | 4.57E-06 | mr1928_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |