\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0200785919:

Variant ID: vg0200785919 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 785919
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGAGGCCCGGCCCGAGCAGGCAACCAAAGAATAAGTTCATTTTGGGTCCCTCTATTTGTAGGTCAGTCTGATTTTCGTCCCTTGGTCGCAAACAAATTTG[C/G]
ATGGACTGGTGCGGGCCAACCAACCAAACAGCCTCAAAGTGAACCCAAAAACCCTAGCGCCGCCGCCGCCGCCATGGAAGAAGCGTGGCCGCCTCTCGCC

Reverse complement sequence

GGCGAGAGGCGGCCACGCTTCTTCCATGGCGGCGGCGGCGGCGCTAGGGTTTTTGGGTTCACTTTGAGGCTGTTTGGTTGGTTGGCCCGCACCAGTCCAT[G/C]
CAAATTTGTTTGCGACCAAGGGACGAAAATCAGACTGACCTACAAATAGAGGGACCCAAAATGAACTTATTCTTTGGTTGCCTGCTCGGGCCGGGCCTCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.20% 2.70% 0.08% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 92.10% 7.60% 0.26% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 99.60% 0.30% 0.13% 0.00% NA
Tropical Japonica  504 79.60% 19.80% 0.60% 0.00% NA
Japonica Intermediate  241 94.60% 5.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0200785919 C -> G LOC_Os02g02350.1 upstream_gene_variant ; 702.0bp to feature; MODIFIER silent_mutation Average:99.555; most accessible tissue: Zhenshan97 panicle, score: 99.891 N N N N
vg0200785919 C -> G LOC_Os02g02360.1 upstream_gene_variant ; 22.0bp to feature; MODIFIER silent_mutation Average:99.555; most accessible tissue: Zhenshan97 panicle, score: 99.891 N N N N
vg0200785919 C -> G LOC_Os02g02350.3 upstream_gene_variant ; 716.0bp to feature; MODIFIER silent_mutation Average:99.555; most accessible tissue: Zhenshan97 panicle, score: 99.891 N N N N
vg0200785919 C -> G LOC_Os02g02350.2 upstream_gene_variant ; 243.0bp to feature; MODIFIER silent_mutation Average:99.555; most accessible tissue: Zhenshan97 panicle, score: 99.891 N N N N
vg0200785919 C -> G LOC_Os02g02370.1 downstream_gene_variant ; 3678.0bp to feature; MODIFIER silent_mutation Average:99.555; most accessible tissue: Zhenshan97 panicle, score: 99.891 N N N N
vg0200785919 C -> G LOC_Os02g02350-LOC_Os02g02360 intergenic_region ; MODIFIER silent_mutation Average:99.555; most accessible tissue: Zhenshan97 panicle, score: 99.891 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0200785919 C G -0.02 -0.03 -0.02 -0.03 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0200785919 NA 3.85E-06 mr1155 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200785919 4.09E-07 3.48E-19 mr1301 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200785919 1.10E-06 6.25E-17 mr1410 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200785919 NA 4.29E-06 mr1155_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200785919 NA 2.36E-06 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200785919 2.75E-06 8.65E-20 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200785919 NA 1.13E-14 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200785919 NA 4.72E-12 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251