\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0200748455:

Variant ID: vg0200748455 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 748455
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTAGTGCCTCTCACAAAAGTACAAATCCCTATGGTAGGGACTTATGTTTTTGTGAGAGGGACTAAAGTTTAGCCCCACTTTAGTCCCCCCAACCAAATA[C/A]
CACCTGAGTCATTTCTTCCTTTTATGTTTCCTACTTCCTTGGTAAGACGAAGGAAGCAGCATGTCTATATTAGTCCATGTATATGTATGCATACAAATGC

Reverse complement sequence

GCATTTGTATGCATACATATACATGGACTAATATAGACATGCTGCTTCCTTCGTCTTACCAAGGAAGTAGGAAACATAAAAGGAAGAAATGACTCAGGTG[G/T]
TATTTGGTTGGGGGGACTAAAGTGGGGCTAAACTTTAGTCCCTCTCACAAAAACATAAGTCCCTACCATAGGGATTTGTACTTTTGTGAGAGGCACTAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.20% 13.80% 0.25% 0.74% NA
All Indica  2759 76.40% 23.30% 0.36% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 87.40% 0.00% 0.00% 12.64% NA
Indica I  595 78.00% 21.30% 0.67% 0.00% NA
Indica II  465 87.30% 12.70% 0.00% 0.00% NA
Indica III  913 64.10% 35.80% 0.11% 0.00% NA
Indica Intermediate  786 83.00% 16.40% 0.64% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 87.80% 8.90% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0200748455 C -> A LOC_Os02g02270.1 downstream_gene_variant ; 2957.0bp to feature; MODIFIER silent_mutation Average:77.716; most accessible tissue: Callus, score: 93.748 N N N N
vg0200748455 C -> A LOC_Os02g02275.1 downstream_gene_variant ; 281.0bp to feature; MODIFIER silent_mutation Average:77.716; most accessible tissue: Callus, score: 93.748 N N N N
vg0200748455 C -> A LOC_Os02g02290.1 downstream_gene_variant ; 249.0bp to feature; MODIFIER silent_mutation Average:77.716; most accessible tissue: Callus, score: 93.748 N N N N
vg0200748455 C -> A LOC_Os02g02275-LOC_Os02g02290 intergenic_region ; MODIFIER silent_mutation Average:77.716; most accessible tissue: Callus, score: 93.748 N N N N
vg0200748455 C -> DEL N N silent_mutation Average:77.716; most accessible tissue: Callus, score: 93.748 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0200748455 C A -0.01 -0.02 -0.02 -0.04 -0.03 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0200748455 NA 7.25E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200748455 NA 1.11E-06 mr1042 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200748455 NA 2.95E-07 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200748455 NA 2.07E-06 mr1043 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200748455 NA 2.70E-07 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200748455 NA 5.17E-07 mr1185 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200748455 NA 1.86E-07 mr1185 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200748455 NA 4.47E-07 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200748455 NA 9.50E-07 mr1269 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200748455 NA 3.16E-06 mr1269 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200748455 NA 4.63E-07 mr1479 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200748455 NA 3.30E-07 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200748455 NA 6.20E-07 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200748455 NA 2.05E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200748455 NA 3.83E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200748455 NA 8.18E-06 mr1543 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200748455 NA 3.28E-07 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200748455 NA 4.24E-07 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200748455 NA 5.02E-07 mr1677 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200748455 9.34E-06 5.13E-08 mr1678 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200748455 NA 6.80E-08 mr1678 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200748455 NA 2.81E-06 mr1725 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200748455 NA 1.14E-06 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200748455 NA 1.64E-06 mr1912 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200748455 5.53E-06 3.95E-08 mr1975 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200748455 NA 2.27E-07 mr1975 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200748455 NA 1.16E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200748455 NA 9.22E-06 mr1291_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200748455 NA 6.18E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251