\
| Variant ID: vg0200658076 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 658076 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 72. )
CCACGTGGTCCTCCCCCGAGGGGAGTCAAGCCCGAGGTGTCACACCCCAATCTGGCACCGTCGTACAACGGCACCTGATAGGAGCGTGTCGTAGGAAAAA[C/T]
GGTGCAAACCGCTCCCTACGAAACCGCGATCTCAGTACCAGTCCCAGGACATAGCGCTGGTACCCACGGTGACAAATATGAATCATTGCAATCCTTAAAA
TTTTAAGGATTGCAATGATTCATATTTGTCACCGTGGGTACCAGCGCTATGTCCTGGGACTGGTACTGAGATCGCGGTTTCGTAGGGAGCGGTTTGCACC[G/A]
TTTTTCCTACGACACGCTCCTATCAGGTGCCGTTGTACGACGGTGCCAGATTGGGGTGTGACACCTCGGGCTTGACTCCCCTCGGGGGAGGACCACGTGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.40% | 6.80% | 0.00% | 1.80% | NA |
| All Indica | 2759 | 91.20% | 8.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.00% | 0.50% | 0.00% | 0.53% | NA |
| Aus | 269 | 74.70% | 7.80% | 0.00% | 17.47% | NA |
| Indica I | 595 | 93.60% | 6.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 80.00% | 20.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 87.40% | 12.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 0.40% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 96.70% | 1.20% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 30.20% | 43.80% | 0.00% | 26.04% | NA |
| Intermediate | 90 | 84.40% | 10.00% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0200658076 | C -> T | LOC_Os02g02170.1 | downstream_gene_variant ; 831.0bp to feature; MODIFIER | silent_mutation | Average:43.861; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0200658076 | C -> T | LOC_Os02g02180.1 | downstream_gene_variant ; 1614.0bp to feature; MODIFIER | silent_mutation | Average:43.861; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0200658076 | C -> T | LOC_Os02g02170-LOC_Os02g02180 | intergenic_region ; MODIFIER | silent_mutation | Average:43.861; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0200658076 | C -> DEL | N | N | silent_mutation | Average:43.861; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0200658076 | NA | 6.76E-06 | mr1049 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200658076 | NA | 5.88E-06 | mr1195 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200658076 | NA | 7.38E-06 | mr1344 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200658076 | NA | 2.70E-06 | mr1432 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200658076 | 7.51E-07 | 7.50E-07 | mr1452 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200658076 | 3.04E-06 | 4.04E-07 | mr1513 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200658076 | 5.43E-06 | 5.43E-06 | mr1513 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200658076 | NA | 1.99E-06 | mr1590 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200658076 | NA | 1.10E-06 | mr1629 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200658076 | NA | 4.42E-07 | mr1704 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200658076 | 4.59E-06 | 4.59E-06 | mr1894 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200658076 | 8.60E-06 | 5.61E-07 | mr1964 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200658076 | NA | 2.95E-06 | mr1976 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |