Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0200643756:

Variant ID: vg0200643756 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 643756
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


CCCTGAGAATCTTCCCATGTTATGTTTTGTTGCTCAATACTGGAGAAGGGAAGGATGGAACCTAACATCCCATCCCTGGTGTCTACTTTATCAGGTTCAG[G/A]
TTACTTCATACCAAAGTTGAAATTGGGTACATGAAGTTGAATAAATAATAGTTGGGTATATATCAAATTATTGTTAAATTGGTATTTTAAAACTTACAAA

Reverse complement sequence

TTTGTAAGTTTTAAAATACCAATTTAACAATAATTTGATATATACCCAACTATTATTTATTCAACTTCATGTACCCAATTTCAACTTTGGTATGAAGTAA[C/T]
CTGAACCTGATAAAGTAGACACCAGGGATGGGATGTTAGGTTCCATCCTTCCCTTCTCCAGTATTGAGCAACAAAACATAACATGGGAAGATTCTCAGGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.50% 26.40% 0.11% 0.00% NA
All Indica  2759 60.70% 39.10% 0.14% 0.00% NA
All Japonica  1512 98.30% 1.70% 0.00% 0.00% NA
Aus  269 81.00% 18.60% 0.37% 0.00% NA
Indica I  595 80.50% 19.20% 0.34% 0.00% NA
Indica II  465 76.30% 23.70% 0.00% 0.00% NA
Indica III  913 38.80% 61.20% 0.00% 0.00% NA
Indica Intermediate  786 62.00% 37.80% 0.25% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 97.00% 3.00% 0.00% 0.00% NA
Japonica Intermediate  241 95.90% 4.10% 0.00% 0.00% NA
VI/Aromatic  96 28.10% 71.90% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0200643756 G -> A LOC_Os02g02140.1 upstream_gene_variant ; 3304.0bp to feature; MODIFIER silent_mutation Average:64.147; most accessible tissue: Callus, score: 89.892 N N N N
vg0200643756 G -> A LOC_Os02g02150.1 upstream_gene_variant ; 2356.0bp to feature; MODIFIER silent_mutation Average:64.147; most accessible tissue: Callus, score: 89.892 N N N N
vg0200643756 G -> A LOC_Os02g02140-LOC_Os02g02150 intergenic_region ; MODIFIER silent_mutation Average:64.147; most accessible tissue: Callus, score: 89.892 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0200643756 G A 0.03 -0.01 0.0 -0.01 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0200643756 NA 2.44E-06 Grain_weight Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0200643756 1.30E-06 1.30E-06 mr1340 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200643756 3.76E-07 3.76E-07 mr1429 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200643756 NA 5.66E-06 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200643756 NA 1.10E-06 mr1678 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200643756 NA 6.26E-07 mr1895 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200643756 NA 1.81E-06 mr1975 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200643756 NA 7.45E-07 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251