\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0200533005:

Variant ID: vg0200533005 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 533005
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTCTTTATTTTTTCGCTGATTGTTATTCCTACCGTACAGATAGATTAGTCTCCTATTTTTACTAGCGATTAGTTTACTAGTAATTTTTAAATCTTAACT[T/C]
TAAAATTTTTAAATTTGGATATGAAAGTTTTCAAATCTCGAGTTGAAAGTTTTCAAATCTCAAGTTGAAAGTTTTCAAGATTTTCAAATCTAGACTTGAA

Reverse complement sequence

TTCAAGTCTAGATTTGAAAATCTTGAAAACTTTCAACTTGAGATTTGAAAACTTTCAACTCGAGATTTGAAAACTTTCATATCCAAATTTAAAAATTTTA[A/G]
AGTTAAGATTTAAAAATTACTAGTAAACTAATCGCTAGTAAAAATAGGAGACTAATCTATCTGTACGGTAGGAATAACAATCAGCGAAAAAATAAAGAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.80% 9.40% 0.42% 0.38% NA
All Indica  2759 82.60% 16.10% 0.72% 0.65% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.00% 0.70% 0.17% 0.17% NA
Indica II  465 87.50% 11.60% 0.86% 0.00% NA
Indica III  913 72.20% 25.80% 0.44% 1.53% NA
Indica Intermediate  786 79.30% 19.00% 1.40% 0.38% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0200533005 T -> DEL N N silent_mutation Average:32.767; most accessible tissue: Callus, score: 57.131 N N N N
vg0200533005 T -> C LOC_Os02g01960.1 downstream_gene_variant ; 1925.0bp to feature; MODIFIER silent_mutation Average:32.767; most accessible tissue: Callus, score: 57.131 N N N N
vg0200533005 T -> C LOC_Os02g01950-LOC_Os02g01960 intergenic_region ; MODIFIER silent_mutation Average:32.767; most accessible tissue: Callus, score: 57.131 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0200533005 NA 5.56E-07 mr1457 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200533005 NA 1.34E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200533005 NA 9.71E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200533005 NA 5.34E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200533005 NA 4.32E-06 mr1720_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200533005 NA 2.63E-07 mr1723_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200533005 NA 4.77E-06 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200533005 NA 2.27E-06 mr1790_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200533005 NA 6.72E-06 mr1922_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200533005 NA 6.19E-08 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251