Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0200533005:

Variant ID: vg0200533005 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 533005
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTCTTTATTTTTTCGCTGATTGTTATTCCTACCGTACAGATAGATTAGTCTCCTATTTTTACTAGCGATTAGTTTACTAGTAATTTTTAAATCTTAACT[T/C]
TAAAATTTTTAAATTTGGATATGAAAGTTTTCAAATCTCGAGTTGAAAGTTTTCAAATCTCAAGTTGAAAGTTTTCAAGATTTTCAAATCTAGACTTGAA

Reverse complement sequence

TTCAAGTCTAGATTTGAAAATCTTGAAAACTTTCAACTTGAGATTTGAAAACTTTCAACTCGAGATTTGAAAACTTTCATATCCAAATTTAAAAATTTTA[A/G]
AGTTAAGATTTAAAAATTACTAGTAAACTAATCGCTAGTAAAAATAGGAGACTAATCTATCTGTACGGTAGGAATAACAATCAGCGAAAAAATAAAGAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.80%	9.40%	0.42%	0.38%	NA
All Indica	2759	82.60%	16.10%	0.72%	0.65%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.00%	0.70%	0.17%	0.17%	NA
Indica II	465	87.50%	11.60%	0.86%	0.00%	NA
Indica III	913	72.20%	25.80%	0.44%	1.53%	NA
Indica Intermediate	786	79.30%	19.00%	1.40%	0.38%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0200533005	T -> DEL	N	N	silent_mutation	Average:32.767; most accessible tissue: Callus, score: 57.131	N	N	N	N
vg0200533005	T -> C	LOC_Os02g01960.1	downstream_gene_variant ; 1925.0bp to feature; MODIFIER	silent_mutation	Average:32.767; most accessible tissue: Callus, score: 57.131	N	N	N	N
vg0200533005	T -> C	LOC_Os02g01950-LOC_Os02g01960	intergenic_region ; MODIFIER	silent_mutation	Average:32.767; most accessible tissue: Callus, score: 57.131	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0200533005	NA	5.56E-07	mr1457	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200533005	NA	1.34E-06	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200533005	NA	9.71E-06	mr1215_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200533005	NA	5.34E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200533005	NA	4.32E-06	mr1720_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200533005	NA	2.63E-07	mr1723_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200533005	NA	4.77E-06	mr1743_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200533005	NA	2.27E-06	mr1790_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200533005	NA	6.72E-06	mr1922_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200533005	NA	6.19E-08	mr1943_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251