\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0200488786:

Variant ID: vg0200488786 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 488786
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, G: 0.07, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


ACTCTTGTTTTGTTTGCTTTGCGTACGTAAGAAAGGAAAAAAAAAAACCTTGACAAAAACACATGATGGATAAGACTAGATGGAATAATATTATATTATT[G/A]
CCTCAAGTATAAATAAAAGTCATTACGGACTTTTTACTAGTACTGCTATTCCAAAATAATATCCACAAGGTAAAGTTAGAATATGAGGAGAGTTAGTACT

Reverse complement sequence

AGTACTAACTCTCCTCATATTCTAACTTTACCTTGTGGATATTATTTTGGAATAGCAGTACTAGTAAAAAGTCCGTAATGACTTTTATTTATACTTGAGG[C/T]
AATAATATAATATTATTCCATCTAGTCTTATCCATCATGTGTTTTTGTCAAGGTTTTTTTTTTTCCTTTCTTACGTACGCAAAGCAAACAAAACAAGAGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.30% 34.40% 0.21% 0.04% NA
All Indica  2759 50.10% 49.60% 0.29% 0.07% NA
All Japonica  1512 99.20% 0.80% 0.00% 0.00% NA
Aus  269 44.60% 55.00% 0.37% 0.00% NA
Indica I  595 12.60% 87.20% 0.17% 0.00% NA
Indica II  465 84.50% 15.50% 0.00% 0.00% NA
Indica III  913 52.90% 46.90% 0.22% 0.00% NA
Indica Intermediate  786 54.70% 44.40% 0.64% 0.25% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 26.00% 72.90% 1.04% 0.00% NA
Intermediate  90 67.80% 32.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0200488786 G -> A LOC_Os02g01890.1 upstream_gene_variant ; 127.0bp to feature; MODIFIER silent_mutation Average:83.301; most accessible tissue: Minghui63 root, score: 98.966 N N N N
vg0200488786 G -> A LOC_Os02g01900.1 upstream_gene_variant ; 2666.0bp to feature; MODIFIER silent_mutation Average:83.301; most accessible tissue: Minghui63 root, score: 98.966 N N N N
vg0200488786 G -> A LOC_Os02g01870.1 downstream_gene_variant ; 4817.0bp to feature; MODIFIER silent_mutation Average:83.301; most accessible tissue: Minghui63 root, score: 98.966 N N N N
vg0200488786 G -> A LOC_Os02g01880.1 downstream_gene_variant ; 924.0bp to feature; MODIFIER silent_mutation Average:83.301; most accessible tissue: Minghui63 root, score: 98.966 N N N N
vg0200488786 G -> A LOC_Os02g01880-LOC_Os02g01890 intergenic_region ; MODIFIER silent_mutation Average:83.301; most accessible tissue: Minghui63 root, score: 98.966 N N N N
vg0200488786 G -> DEL N N silent_mutation Average:83.301; most accessible tissue: Minghui63 root, score: 98.966 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0200488786 G A -0.09 -0.05 -0.01 -0.02 -0.05 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0200488786 NA 2.64E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200488786 NA 8.05E-09 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200488786 NA 7.27E-07 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200488786 NA 3.47E-07 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200488786 NA 2.53E-07 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200488786 NA 4.30E-06 mr1097_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200488786 NA 1.68E-08 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200488786 NA 5.84E-06 mr1148_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200488786 NA 1.78E-07 mr1154_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200488786 NA 1.52E-06 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200488786 NA 5.84E-06 mr1291_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200488786 NA 2.52E-08 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200488786 NA 6.65E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200488786 NA 5.44E-09 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200488786 NA 5.51E-09 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200488786 NA 5.64E-07 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200488786 NA 3.34E-06 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200488786 NA 1.64E-10 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200488786 NA 6.29E-08 mr1835_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200488786 NA 1.03E-08 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200488786 NA 2.18E-16 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200488786 NA 6.67E-12 mr1904_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200488786 NA 4.16E-06 mr1928_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200488786 NA 8.91E-09 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251