\
| Variant ID: vg0200474832 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 474832 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCTCTATTGAAACCTATGGTGCTGAAGTTAATCTTTGCCAATCAGTACTATCTATCTATCTATTATATAATATATAATTAAATGAATAGAAAAAAGGAGC[C/A]
TCCACGTTCGCTCTCATGGCCTAGAAATTCTCACATTAATCGGAGAAAAAGAAGAAAAAGAAAAAGCAGAGTCCATATAGAAATACAATTTAAAAATAGA
TCTATTTTTAAATTGTATTTCTATATGGACTCTGCTTTTTCTTTTTCTTCTTTTTCTCCGATTAATGTGAGAATTTCTAGGCCATGAGAGCGAACGTGGA[G/T]
GCTCCTTTTTTCTATTCATTTAATTATATATTATATAATAGATAGATAGATAGTACTGATTGGCAAAGATTAACTTCAGCACCATAGGTTTCAATAGAGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.80% | 4.10% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 52.80% | 45.00% | 2.23% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 71.90% | 28.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0200474832 | C -> A | LOC_Os02g01850.1 | upstream_gene_variant ; 3157.0bp to feature; MODIFIER | silent_mutation | Average:36.145; most accessible tissue: Zhenshan97 root, score: 88.474 | N | N | N | N |
| vg0200474832 | C -> A | LOC_Os02g01860.1 | downstream_gene_variant ; 2633.0bp to feature; MODIFIER | silent_mutation | Average:36.145; most accessible tissue: Zhenshan97 root, score: 88.474 | N | N | N | N |
| vg0200474832 | C -> A | LOC_Os02g01850-LOC_Os02g01860 | intergenic_region ; MODIFIER | silent_mutation | Average:36.145; most accessible tissue: Zhenshan97 root, score: 88.474 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0200474832 | NA | 2.48E-06 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 2.73E-07 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 2.41E-06 | mr1007 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 4.79E-06 | mr1048 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 1.50E-07 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 8.33E-06 | mr1054 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 3.34E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 8.05E-14 | mr1166 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 3.89E-08 | mr1207 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 5.83E-07 | mr1209 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | 8.37E-06 | 8.36E-06 | mr1214 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 2.77E-06 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 9.95E-10 | mr1230 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 5.62E-07 | mr1283 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 3.87E-08 | mr1286 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 7.43E-06 | mr1287 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 4.34E-06 | mr1294 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 8.15E-06 | mr1297 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 1.39E-10 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 1.33E-07 | mr1312 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 9.52E-06 | mr1331 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 3.66E-07 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 6.17E-07 | mr1393 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 1.48E-07 | mr1400 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | 3.92E-06 | 2.14E-09 | mr1417 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 9.47E-06 | mr1432 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 1.85E-06 | mr1434 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 2.66E-06 | mr1467 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 6.10E-06 | mr1507 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 6.90E-07 | mr1512 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 2.43E-18 | mr1515 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 1.79E-06 | mr1556 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 8.75E-06 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | 9.83E-06 | 9.82E-06 | mr1605 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 1.83E-11 | mr1612 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 4.69E-06 | mr1634 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 9.29E-08 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 1.20E-06 | mr1687 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 2.57E-06 | mr1724 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 2.53E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 1.73E-07 | mr1774 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 1.32E-06 | mr1777 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 6.10E-06 | mr1884 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 1.55E-10 | mr1939 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 8.10E-07 | mr1985 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 6.68E-06 | mr1344_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 5.28E-07 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 7.49E-09 | mr1741_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 9.60E-07 | mr1792_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | NA | 2.98E-06 | mr1815_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | 9.53E-06 | NA | mr1936_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200474832 | 6.23E-06 | NA | mr1993_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |