\
| Variant ID: vg0200471574 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 471574 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTCCGCCGCAGACGCCACCGGCTTCGCCGTAGACGCCGCCGCCACAGCCGCCACCACCACGCTCACGCCACTCTCCCTCTCTGGCACTACTGACCTTGTG[C/T]
GCATCGGCGCCGCTGAAGAGGAGGAGCCGCAAGCAGGCTCCGCCGCCGGCTCCGCCCGCCGCCGACTCCGCCACCGCCGCCGGCTCCGCCGCCGCAGCCA
TGGCTGCGGCGGCGGAGCCGGCGGCGGTGGCGGAGTCGGCGGCGGGCGGAGCCGGCGGCGGAGCCTGCTTGCGGCTCCTCCTCTTCAGCGGCGCCGATGC[G/A]
CACAAGGTCAGTAGTGCCAGAGAGGGAGAGTGGCGTGAGCGTGGTGGTGGCGGCTGTGGCGGCGGCGTCTACGGCGAAGCCGGTGGCGTCTGCGGCGGAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.50% | 7.20% | 6.45% | 2.84% | NA |
| All Indica | 2759 | 82.60% | 12.20% | 3.37% | 1.85% | NA |
| All Japonica | 1512 | 81.40% | 0.00% | 13.49% | 5.09% | NA |
| Aus | 269 | 97.80% | 0.00% | 0.74% | 1.49% | NA |
| Indica I | 595 | 98.50% | 0.80% | 0.50% | 0.17% | NA |
| Indica II | 465 | 84.30% | 8.00% | 4.95% | 2.80% | NA |
| Indica III | 913 | 72.60% | 20.40% | 4.49% | 2.52% | NA |
| Indica Intermediate | 786 | 81.20% | 13.70% | 3.31% | 1.78% | NA |
| Temperate Japonica | 767 | 75.00% | 0.00% | 19.95% | 5.08% | NA |
| Tropical Japonica | 504 | 90.30% | 0.00% | 4.37% | 5.36% | NA |
| Japonica Intermediate | 241 | 83.40% | 0.00% | 12.03% | 4.56% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 4.40% | 4.44% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0200471574 | C -> T | LOC_Os02g01850.1 | synonymous_variant ; p.Ala34Ala; LOW | synonymous_codon | Average:67.177; most accessible tissue: Minghui63 panicle, score: 93.294 | N | N | N | N |
| vg0200471574 | C -> DEL | LOC_Os02g01850.1 | N | frameshift_variant | Average:67.177; most accessible tissue: Minghui63 panicle, score: 93.294 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0200471574 | NA | 9.80E-06 | mr1075 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200471574 | NA | 5.44E-06 | mr1124 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200471574 | NA | 6.13E-07 | mr1457 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200471574 | NA | 4.72E-09 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200471574 | NA | 8.69E-06 | mr1074_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200471574 | 5.75E-06 | 5.75E-06 | mr1081_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200471574 | NA | 9.33E-06 | mr1711_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200471574 | NA | 3.68E-06 | mr1743_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200471574 | 2.53E-06 | 1.94E-07 | mr1790_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200471574 | 2.95E-06 | 5.47E-07 | mr1805_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200471574 | NA | 9.55E-06 | mr1943_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |