\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0200469050:

Variant ID: vg0200469050 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 469050
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCGCGATTCCGAGTCGGCGCGAACTCCTCCACAACCCGACGAATCCTCCTCGGAATCGCGCGCCTCCGTGCGTGATTCCTCACCGGCGCAAGCTCCTCC[G/A]
CATCCCGAAGATTCATTCGCGGAATCGCGTGCCTCCATGCTCGTTTCCTCGACTGATTCCATTGGCGCACACGTTGTCTGCCAATTTCCTCTGCAATCCG

Reverse complement sequence

CGGATTGCAGAGGAAATTGGCAGACAACGTGTGCGCCAATGGAATCAGTCGAGGAAACGAGCATGGAGGCACGCGATTCCGCGAATGAATCTTCGGGATG[C/T]
GGAGGAGCTTGCGCCGGTGAGGAATCACGCACGGAGGCGCGCGATTCCGAGGAGGATTCGTCGGGTTGTGGAGGAGTTCGCGCCGACTCGGAATCGCGCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.80% 4.40% 0.02% 0.78% NA
All Indica  2759 91.20% 7.40% 0.04% 1.34% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 82.50% 17.50% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 91.60% 4.40% 0.00% 4.05% NA
Indica Intermediate  786 92.60% 7.30% 0.13% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0200469050 G -> A LOC_Os02g01840.1 downstream_gene_variant ; 4067.0bp to feature; MODIFIER silent_mutation Average:35.482; most accessible tissue: Zhenshan97 young leaf, score: 53.969 N N N N
vg0200469050 G -> A LOC_Os02g01850.1 downstream_gene_variant ; 1440.0bp to feature; MODIFIER silent_mutation Average:35.482; most accessible tissue: Zhenshan97 young leaf, score: 53.969 N N N N
vg0200469050 G -> A LOC_Os02g01840-LOC_Os02g01850 intergenic_region ; MODIFIER silent_mutation Average:35.482; most accessible tissue: Zhenshan97 young leaf, score: 53.969 N N N N
vg0200469050 G -> DEL N N silent_mutation Average:35.482; most accessible tissue: Zhenshan97 young leaf, score: 53.969 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0200469050 NA 1.80E-08 mr1291_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200469050 9.08E-06 1.68E-08 mr1291_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200469050 NA 8.59E-06 mr1892_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200469050 NA 4.27E-06 mr1892_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251