\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0200460907:

Variant ID: vg0200460907 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 460907
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:


TCCTAAAAACCTTTTATGGTATCAGAGCCCGAAATCGCCAGAATCAGATCGCATCTGTTATGGCGAGTTCCTCCATCAGCGCCGGCAATCCCTTCTCTGG[C/T]
CATGCCGTCCCTAAGAAGCTAACCAGGACGAATTTCCTTTTATGGAAAGGGCAAATCCTCCCGGTGATCCGCGGTGCGCGTTTGGAAGGTTACCTCACAG

Reverse complement sequence

CTGTGAGGTAACCTTCCAAACGCGCACCGCGGATCACCGGGAGGATTTGCCCTTTCCATAAAAGGAAATTCGTCCTGGTTAGCTTCTTAGGGACGGCATG[G/A]
CCAGAGAAGGGATTGCCGGCGCTGATGGAGGAACTCGCCATAACAGATGCGATCTGATTCTGGCGATTTCGGGCTCTGATACCATAAAAGGTTTTTAGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.40% 3.60% 0.57% 6.43% NA
All Indica  2759 84.10% 5.40% 0.91% 9.53% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 94.40% 1.90% 0.74% 2.97% NA
Indica I  595 99.00% 0.80% 0.00% 0.17% NA
Indica II  465 89.20% 5.80% 1.29% 3.66% NA
Indica III  913 72.80% 6.90% 0.99% 19.28% NA
Indica Intermediate  786 83.00% 7.00% 1.27% 8.78% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 60.40% 11.50% 0.00% 28.12% NA
Intermediate  90 90.00% 3.30% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0200460907 C -> T LOC_Os02g01840.1 synonymous_variant ; p.Gly14Gly; LOW synonymous_codon Average:69.133; most accessible tissue: Zhenshan97 flower, score: 92.192 N N N N
vg0200460907 C -> DEL LOC_Os02g01840.1 N frameshift_variant Average:69.133; most accessible tissue: Zhenshan97 flower, score: 92.192 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0200460907 C T -0.01 -0.02 -0.01 -0.01 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0200460907 NA 4.19E-06 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200460907 NA 1.49E-06 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200460907 NA 6.47E-06 mr1457 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200460907 NA 1.37E-08 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200460907 NA 7.29E-06 mr1574 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200460907 NA 4.37E-07 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200460907 NA 4.07E-06 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200460907 1.76E-06 1.76E-06 mr1081_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200460907 NA 2.36E-06 mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200460907 NA 4.22E-06 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200460907 NA 7.18E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200460907 NA 6.54E-06 mr1146_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200460907 NA 4.12E-06 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200460907 NA 4.02E-06 mr1790_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251