\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0200459861:

Variant ID: vg0200459861 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 459861
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.65, T: 0.35, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


GCTTTCCCCATCGAGCCGGCGAGCTTCTCCGACGAGGACGGTGGCGGCGGCACGGATCGAAGCGGCGCAGCGACGAGCTCCCCGGCGACATCGAGGTCAG[T/C]
GACGCGGAGCGGGAGACGGCAACGAGGTCGACGCTGGAGAGGGCGCGAGGGGACGACGAGTTGGAGGCACGCCCTCCACAGCGCGAGCTCTAGGCGTTCC

Reverse complement sequence

GGAACGCCTAGAGCTCGCGCTGTGGAGGGCGTGCCTCCAACTCGTCGTCCCCTCGCGCCCTCTCCAGCGTCGACCTCGTTGCCGTCTCCCGCTCCGCGTC[A/G]
CTGACCTCGATGTCGCCGGGGAGCTCGTCGCTGCGCCGCTTCGATCCGTGCCGCCGCCACCGTCCTCGTCGGAGAAGCTCGCCGGCTCGATGGGGAAAGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.20% 37.70% 0.11% 0.00% NA
All Indica  2759 45.50% 54.50% 0.07% 0.00% NA
All Japonica  1512 98.10% 1.90% 0.07% 0.00% NA
Aus  269 43.90% 55.40% 0.74% 0.00% NA
Indica I  595 66.10% 33.80% 0.17% 0.00% NA
Indica II  465 59.60% 40.40% 0.00% 0.00% NA
Indica III  913 32.20% 67.80% 0.00% 0.00% NA
Indica Intermediate  786 36.90% 63.00% 0.13% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 96.80% 3.20% 0.00% 0.00% NA
Japonica Intermediate  241 96.30% 3.30% 0.41% 0.00% NA
VI/Aromatic  96 25.00% 75.00% 0.00% 0.00% NA
Intermediate  90 66.70% 33.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0200459861 T -> C LOC_Os02g01830.1 5_prime_UTR_variant ; 419.0bp to feature; MODIFIER silent_mutation Average:93.078; most accessible tissue: Zhenshan97 panicle, score: 99.328 N N N N
vg0200459861 T -> C LOC_Os02g01825.1 upstream_gene_variant ; 2217.0bp to feature; MODIFIER silent_mutation Average:93.078; most accessible tissue: Zhenshan97 panicle, score: 99.328 N N N N
vg0200459861 T -> C LOC_Os02g01840.1 upstream_gene_variant ; 1005.0bp to feature; MODIFIER silent_mutation Average:93.078; most accessible tissue: Zhenshan97 panicle, score: 99.328 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0200459861 T C -0.01 -0.01 0.0 -0.03 -0.03 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0200459861 NA 4.27E-08 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200459861 NA 3.79E-07 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200459861 NA 5.09E-08 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200459861 NA 2.71E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200459861 NA 8.00E-09 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200459861 NA 1.63E-08 mr1002_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200459861 NA 3.01E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200459861 NA 7.59E-08 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200459861 NA 2.00E-06 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200459861 NA 1.39E-06 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200459861 NA 3.83E-07 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200459861 NA 4.32E-06 mr1269_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200459861 NA 7.62E-10 mr1352_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200459861 NA 9.96E-06 mr1457_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200459861 NA 6.19E-10 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200459861 NA 5.69E-06 mr1677_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200459861 NA 2.74E-07 mr1882_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251