\
| Variant ID: vg0200452314 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 452314 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 336. )
CTTAGGGTCACCAATTAGAGAGATTGCAACGCTGAGACGACGTTTCATGCCACCACTGTATTTGCTTACAAGCTTATCGGCAATGCCACCAGCAAACAGG[C/T]
GCACATTTTTCAAAGATTTCTCAATGGCCTAAAAAAATAAGAAATAGGAGATCTTAGATGATTGCTTCAGAACTTGTATTTATAATAATTTCTCGTGAAA
TTTCACGAGAAATTATTATAAATACAAGTTCTGAAGCAATCATCTAAGATCTCCTATTTCTTATTTTTTTAGGCCATTGAGAAATCTTTGAAAAATGTGC[G/A]
CCTGTTTGCTGGTGGCATTGCCGATAAGCTTGTAAGCAAATACAGTGGTGGCATGAAACGTCGTCTCAGCGTTGCAATCTCTCTAATTGGTGACCCTAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.30% | 9.60% | 1.93% | 1.16% | NA |
| All Indica | 2759 | 78.60% | 16.10% | 3.30% | 1.99% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.90% | 5.50% | 1.34% | 0.17% | NA |
| Indica II | 465 | 86.90% | 11.60% | 1.29% | 0.22% | NA |
| Indica III | 913 | 70.00% | 21.40% | 4.16% | 4.49% | NA |
| Indica Intermediate | 786 | 72.90% | 20.60% | 4.96% | 1.53% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0200452314 | C -> T | LOC_Os02g01820.1 | missense_variant ; p.Arg188His; MODERATE | nonsynonymous_codon ; R188H | Average:43.247; most accessible tissue: Minghui63 flower, score: 57.187 | probably damaging |
2.509 |
DELETERIOUS | 0.01 |
| vg0200452314 | C -> DEL | LOC_Os02g01820.1 | N | frameshift_variant | Average:43.247; most accessible tissue: Minghui63 flower, score: 57.187 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0200452314 | NA | 7.08E-06 | mr1042 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200452314 | NA | 4.09E-06 | mr1042 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200452314 | NA | 1.70E-06 | mr1043 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200452314 | NA | 5.37E-07 | mr1043 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200452314 | NA | 1.74E-08 | mr1457 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200452314 | 9.31E-08 | NA | mr1458 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200452314 | 1.62E-06 | 4.45E-12 | mr1458 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200452314 | NA | 1.64E-06 | mr1595 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200452314 | NA | 3.30E-06 | mr1619 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200452314 | NA | 8.66E-10 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200452314 | NA | 1.32E-06 | mr1469_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |