\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0200452314:

Variant ID: vg0200452314 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 452314
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 336. )

Flanking Sequence (100 bp) in Reference Genome:


CTTAGGGTCACCAATTAGAGAGATTGCAACGCTGAGACGACGTTTCATGCCACCACTGTATTTGCTTACAAGCTTATCGGCAATGCCACCAGCAAACAGG[C/T]
GCACATTTTTCAAAGATTTCTCAATGGCCTAAAAAAATAAGAAATAGGAGATCTTAGATGATTGCTTCAGAACTTGTATTTATAATAATTTCTCGTGAAA

Reverse complement sequence

TTTCACGAGAAATTATTATAAATACAAGTTCTGAAGCAATCATCTAAGATCTCCTATTTCTTATTTTTTTAGGCCATTGAGAAATCTTTGAAAAATGTGC[G/A]
CCTGTTTGCTGGTGGCATTGCCGATAAGCTTGTAAGCAAATACAGTGGTGGCATGAAACGTCGTCTCAGCGTTGCAATCTCTCTAATTGGTGACCCTAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.30% 9.60% 1.93% 1.16% NA
All Indica  2759 78.60% 16.10% 3.30% 1.99% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 92.90% 5.50% 1.34% 0.17% NA
Indica II  465 86.90% 11.60% 1.29% 0.22% NA
Indica III  913 70.00% 21.40% 4.16% 4.49% NA
Indica Intermediate  786 72.90% 20.60% 4.96% 1.53% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0200452314 C -> T LOC_Os02g01820.1 missense_variant ; p.Arg188His; MODERATE nonsynonymous_codon ; R188H Average:43.247; most accessible tissue: Minghui63 flower, score: 57.187 probably damaging 2.509 DELETERIOUS 0.01
vg0200452314 C -> DEL LOC_Os02g01820.1 N frameshift_variant Average:43.247; most accessible tissue: Minghui63 flower, score: 57.187 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0200452314 NA 7.08E-06 mr1042 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200452314 NA 4.09E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200452314 NA 1.70E-06 mr1043 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200452314 NA 5.37E-07 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200452314 NA 1.74E-08 mr1457 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200452314 9.31E-08 NA mr1458 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200452314 1.62E-06 4.45E-12 mr1458 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200452314 NA 1.64E-06 mr1595 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200452314 NA 3.30E-06 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200452314 NA 8.66E-10 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200452314 NA 1.32E-06 mr1469_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251