\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0200277506:

Variant ID: vg0200277506 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 277506
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


ACCTCTGCTGATCAGATGTACTCCCTCCGTACCACAAAAAAACCGAATCTAGGACTGGATGTGGCACATCTTAGTATGTATGTCCAGATTCATTGTACAA[A/G]
GATATGTCACATCCAGTACTAGGTTTTTTATGGGACGGAGGGAGTAATAGATAGCTTACATATACTCTATTCGGTCATAAATTGTTGACGTCTCGGACAA

Reverse complement sequence

TTGTCCGAGACGTCAACAATTTATGACCGAATAGAGTATATGTAAGCTATCTATTACTCCCTCCGTCCCATAAAAAACCTAGTACTGGATGTGACATATC[T/C]
TTGTACAATGAATCTGGACATACATACTAAGATGTGCCACATCCAGTCCTAGATTCGGTTTTTTTGTGGTACGGAGGGAGTACATCTGATCAGCAGAGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.90% 15.20% 2.90% 0.00% NA
All Indica  2759 95.00% 4.00% 1.01% 0.00% NA
All Japonica  1512 62.00% 31.20% 6.81% 0.00% NA
Aus  269 55.40% 43.50% 1.12% 0.00% NA
Indica I  595 95.80% 1.00% 3.19% 0.00% NA
Indica II  465 97.40% 1.50% 1.08% 0.00% NA
Indica III  913 90.80% 9.20% 0.00% 0.00% NA
Indica Intermediate  786 97.80% 1.70% 0.51% 0.00% NA
Temperate Japonica  767 36.20% 52.80% 10.95% 0.00% NA
Tropical Japonica  504 93.80% 4.20% 1.98% 0.00% NA
Japonica Intermediate  241 77.20% 19.10% 3.73% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 81.10% 15.60% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0200277506 A -> G LOC_Os02g01470.1 upstream_gene_variant ; 4003.0bp to feature; MODIFIER silent_mutation Average:57.623; most accessible tissue: Callus, score: 90.636 N N N N
vg0200277506 A -> G LOC_Os02g01490.1 upstream_gene_variant ; 2077.0bp to feature; MODIFIER silent_mutation Average:57.623; most accessible tissue: Callus, score: 90.636 N N N N
vg0200277506 A -> G LOC_Os02g01480.1 downstream_gene_variant ; 249.0bp to feature; MODIFIER silent_mutation Average:57.623; most accessible tissue: Callus, score: 90.636 N N N N
vg0200277506 A -> G LOC_Os02g01480-LOC_Os02g01490 intergenic_region ; MODIFIER silent_mutation Average:57.623; most accessible tissue: Callus, score: 90.636 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0200277506 NA 1.48E-14 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0200277506 NA 2.92E-15 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0200277506 NA 2.27E-08 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200277506 NA 6.78E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200277506 NA 2.88E-09 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200277506 NA 3.29E-09 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200277506 NA 8.01E-08 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200277506 NA 3.57E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200277506 NA 3.28E-10 mr1330_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200277506 NA 8.06E-06 mr1561_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200277506 NA 7.27E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200277506 NA 8.22E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200277506 5.29E-06 NA mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200277506 NA 2.48E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200277506 NA 5.20E-07 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200277506 NA 2.73E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200277506 NA 7.56E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251