\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0200274146:

Variant ID: vg0200274146 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 274146
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.07, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGAATTGAGTAAATTTCATCATTAGCACAAAGATGAGTCAGTTTCAAACAGTAAAACCATAAAATTTTAAGGGTGCTAATAAAAACCACAGGAAACAC[G/A]
ATAAAAATGTTTCCGAAAATTAACAATCGACTATTTTTAATCATCAATTGATATATTATAGTACTATATATAGTTAGCAGATCCAACAAATGACAGCTGT

Reverse complement sequence

ACAGCTGTCATTTGTTGGATCTGCTAACTATATATAGTACTATAATATATCAATTGATGATTAAAAATAGTCGATTGTTAATTTTCGGAAACATTTTTAT[C/T]
GTGTTTCCTGTGGTTTTTATTAGCACCCTTAAAATTTTATGGTTTTACTGTTTGAAACTGACTCATCTTTGTGCTAATGATGAAATTTACTCAATTCAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.60% 46.00% 0.36% 0.02% NA
All Indica  2759 29.40% 70.10% 0.51% 0.04% NA
All Japonica  1512 98.50% 1.50% 0.00% 0.00% NA
Aus  269 49.40% 50.60% 0.00% 0.00% NA
Indica I  595 32.90% 66.70% 0.34% 0.00% NA
Indica II  465 26.70% 72.90% 0.43% 0.00% NA
Indica III  913 28.40% 71.30% 0.33% 0.00% NA
Indica Intermediate  786 29.40% 69.60% 0.89% 0.13% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 49.00% 50.00% 1.04% 0.00% NA
Intermediate  90 60.00% 37.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0200274146 G -> A LOC_Os02g01460.1 upstream_gene_variant ; 2794.0bp to feature; MODIFIER silent_mutation Average:49.58; most accessible tissue: Minghui63 flower, score: 64.685 N N N N
vg0200274146 G -> A LOC_Os02g01470.1 upstream_gene_variant ; 643.0bp to feature; MODIFIER silent_mutation Average:49.58; most accessible tissue: Minghui63 flower, score: 64.685 N N N N
vg0200274146 G -> A LOC_Os02g01480.1 upstream_gene_variant ; 282.0bp to feature; MODIFIER silent_mutation Average:49.58; most accessible tissue: Minghui63 flower, score: 64.685 N N N N
vg0200274146 G -> A LOC_Os02g01470-LOC_Os02g01480 intergenic_region ; MODIFIER silent_mutation Average:49.58; most accessible tissue: Minghui63 flower, score: 64.685 N N N N
vg0200274146 G -> DEL N N silent_mutation Average:49.58; most accessible tissue: Minghui63 flower, score: 64.685 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0200274146 9.01E-09 9.01E-09 mr1024 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200274146 8.36E-08 3.24E-09 mr1565 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200274146 NA 9.48E-06 mr1940 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200274146 8.92E-12 8.92E-12 mr1024_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200274146 NA 1.55E-06 mr1038_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200274146 2.50E-07 4.14E-10 mr1565_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200274146 1.73E-06 1.73E-06 mr1915_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200274146 1.10E-07 1.10E-07 mr1940_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251