Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0200274146:

Variant ID: vg0200274146 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 274146
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.07, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

TTTGAATTGAGTAAATTTCATCATTAGCACAAAGATGAGTCAGTTTCAAACAGTAAAACCATAAAATTTTAAGGGTGCTAATAAAAACCACAGGAAACAC[G/A]
ATAAAAATGTTTCCGAAAATTAACAATCGACTATTTTTAATCATCAATTGATATATTATAGTACTATATATAGTTAGCAGATCCAACAAATGACAGCTGT

Reverse complement sequence

ACAGCTGTCATTTGTTGGATCTGCTAACTATATATAGTACTATAATATATCAATTGATGATTAAAAATAGTCGATTGTTAATTTTCGGAAACATTTTTAT[C/T]
GTGTTTCCTGTGGTTTTTATTAGCACCCTTAAAATTTTATGGTTTTACTGTTTGAAACTGACTCATCTTTGTGCTAATGATGAAATTTACTCAATTCAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.60%	46.00%	0.36%	0.02%	NA
All Indica	2759	29.40%	70.10%	0.51%	0.04%	NA
All Japonica	1512	98.50%	1.50%	0.00%	0.00%	NA
Aus	269	49.40%	50.60%	0.00%	0.00%	NA
Indica I	595	32.90%	66.70%	0.34%	0.00%	NA
Indica II	465	26.70%	72.90%	0.43%	0.00%	NA
Indica III	913	28.40%	71.30%	0.33%	0.00%	NA
Indica Intermediate	786	29.40%	69.60%	0.89%	0.13%	NA
Temperate Japonica	767	98.70%	1.30%	0.00%	0.00%	NA
Tropical Japonica	504	98.80%	1.20%	0.00%	0.00%	NA
Japonica Intermediate	241	97.10%	2.90%	0.00%	0.00%	NA
VI/Aromatic	96	49.00%	50.00%	1.04%	0.00%	NA
Intermediate	90	60.00%	37.80%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0200274146	G -> A	LOC_Os02g01460.1	upstream_gene_variant ; 2794.0bp to feature; MODIFIER	silent_mutation	Average:49.58; most accessible tissue: Minghui63 flower, score: 64.685	N	N	N	N
vg0200274146	G -> A	LOC_Os02g01470.1	upstream_gene_variant ; 643.0bp to feature; MODIFIER	silent_mutation	Average:49.58; most accessible tissue: Minghui63 flower, score: 64.685	N	N	N	N
vg0200274146	G -> A	LOC_Os02g01480.1	upstream_gene_variant ; 282.0bp to feature; MODIFIER	silent_mutation	Average:49.58; most accessible tissue: Minghui63 flower, score: 64.685	N	N	N	N
vg0200274146	G -> A	LOC_Os02g01470-LOC_Os02g01480	intergenic_region ; MODIFIER	silent_mutation	Average:49.58; most accessible tissue: Minghui63 flower, score: 64.685	N	N	N	N
vg0200274146	G -> DEL	N	N	silent_mutation	Average:49.58; most accessible tissue: Minghui63 flower, score: 64.685	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0200274146	9.01E-09	9.01E-09	mr1024	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200274146	8.36E-08	3.24E-09	mr1565	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200274146	NA	9.48E-06	mr1940	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200274146	8.92E-12	8.92E-12	mr1024_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200274146	NA	1.55E-06	mr1038_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200274146	2.50E-07	4.14E-10	mr1565_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200274146	1.73E-06	1.73E-06	mr1915_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200274146	1.10E-07	1.10E-07	mr1940_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251