\
| Variant ID: vg0200274146 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 274146 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.07, others allele: 0.00, population size: 105. )
TTTGAATTGAGTAAATTTCATCATTAGCACAAAGATGAGTCAGTTTCAAACAGTAAAACCATAAAATTTTAAGGGTGCTAATAAAAACCACAGGAAACAC[G/A]
ATAAAAATGTTTCCGAAAATTAACAATCGACTATTTTTAATCATCAATTGATATATTATAGTACTATATATAGTTAGCAGATCCAACAAATGACAGCTGT
ACAGCTGTCATTTGTTGGATCTGCTAACTATATATAGTACTATAATATATCAATTGATGATTAAAAATAGTCGATTGTTAATTTTCGGAAACATTTTTAT[C/T]
GTGTTTCCTGTGGTTTTTATTAGCACCCTTAAAATTTTATGGTTTTACTGTTTGAAACTGACTCATCTTTGTGCTAATGATGAAATTTACTCAATTCAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.60% | 46.00% | 0.36% | 0.02% | NA |
| All Indica | 2759 | 29.40% | 70.10% | 0.51% | 0.04% | NA |
| All Japonica | 1512 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 49.40% | 50.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 32.90% | 66.70% | 0.34% | 0.00% | NA |
| Indica II | 465 | 26.70% | 72.90% | 0.43% | 0.00% | NA |
| Indica III | 913 | 28.40% | 71.30% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 29.40% | 69.60% | 0.89% | 0.13% | NA |
| Temperate Japonica | 767 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 49.00% | 50.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 37.80% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0200274146 | G -> A | LOC_Os02g01460.1 | upstream_gene_variant ; 2794.0bp to feature; MODIFIER | silent_mutation | Average:49.58; most accessible tissue: Minghui63 flower, score: 64.685 | N | N | N | N |
| vg0200274146 | G -> A | LOC_Os02g01470.1 | upstream_gene_variant ; 643.0bp to feature; MODIFIER | silent_mutation | Average:49.58; most accessible tissue: Minghui63 flower, score: 64.685 | N | N | N | N |
| vg0200274146 | G -> A | LOC_Os02g01480.1 | upstream_gene_variant ; 282.0bp to feature; MODIFIER | silent_mutation | Average:49.58; most accessible tissue: Minghui63 flower, score: 64.685 | N | N | N | N |
| vg0200274146 | G -> A | LOC_Os02g01470-LOC_Os02g01480 | intergenic_region ; MODIFIER | silent_mutation | Average:49.58; most accessible tissue: Minghui63 flower, score: 64.685 | N | N | N | N |
| vg0200274146 | G -> DEL | N | N | silent_mutation | Average:49.58; most accessible tissue: Minghui63 flower, score: 64.685 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0200274146 | 9.01E-09 | 9.01E-09 | mr1024 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200274146 | 8.36E-08 | 3.24E-09 | mr1565 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200274146 | NA | 9.48E-06 | mr1940 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200274146 | 8.92E-12 | 8.92E-12 | mr1024_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200274146 | NA | 1.55E-06 | mr1038_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200274146 | 2.50E-07 | 4.14E-10 | mr1565_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200274146 | 1.73E-06 | 1.73E-06 | mr1915_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200274146 | 1.10E-07 | 1.10E-07 | mr1940_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |