\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0200213199:

Variant ID: vg0200213199 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 213199
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.81, G: 0.20, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


TTCATATTGATGTTAATGAATCTAGACATATATATCTATCTAGATTCATTAATATCAATATAAATGTAGAAAATGCTAGAATGACTTACATTGTGAAACG[G/A,T]
GGGAAGTAACTATTAACCGATATATCTATTTATTTTAATATAAATTAGTTAGAATTGAATAATTTACCCGAGATCCTATGTCCCTAGGAAGATTAAGATA

Reverse complement sequence

TATCTTAATCTTCCTAGGGACATAGGATCTCGGGTAAATTATTCAATTCTAACTAATTTATATTAAAATAAATAGATATATCGGTTAATAGTTACTTCCC[C/T,A]
CGTTTCACAATGTAAGTCATTCTAGCATTTTCTACATTTATATTGATATTAATGAATCTAGATAGATATATATGTCTAGATTCATTAACATCAATATGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.50% 43.00% 0.32% 0.17% T: 0.04%
All Indica  2759 34.10% 65.20% 0.43% 0.18% T: 0.07%
All Japonica  1512 99.20% 0.70% 0.07% 0.07% NA
Aus  269 47.60% 52.40% 0.00% 0.00% NA
Indica I  595 28.70% 70.40% 0.84% 0.00% NA
Indica II  465 17.60% 82.20% 0.22% 0.00% NA
Indica III  913 44.80% 54.50% 0.33% 0.11% T: 0.22%
Indica Intermediate  786 35.40% 63.70% 0.38% 0.51% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 0.80% 0.20% 0.00% NA
Japonica Intermediate  241 97.90% 1.70% 0.00% 0.41% NA
VI/Aromatic  96 50.00% 50.00% 0.00% 0.00% NA
Intermediate  90 61.10% 34.40% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0200213199 G -> A LOC_Os02g01370.1 downstream_gene_variant ; 3862.0bp to feature; MODIFIER silent_mutation Average:51.487; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N
vg0200213199 G -> A LOC_Os02g01370-LOC_Os02g01380 intergenic_region ; MODIFIER silent_mutation Average:51.487; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N
vg0200213199 G -> T LOC_Os02g01370.1 downstream_gene_variant ; 3862.0bp to feature; MODIFIER silent_mutation Average:51.487; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N
vg0200213199 G -> T LOC_Os02g01370-LOC_Os02g01380 intergenic_region ; MODIFIER silent_mutation Average:51.487; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N
vg0200213199 G -> DEL N N silent_mutation Average:51.487; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0200213199 NA 3.46E-10 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200213199 NA 6.68E-06 mr1677 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200213199 NA 1.48E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200213199 NA 2.15E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200213199 NA 2.40E-07 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200213199 NA 4.12E-08 mr1045_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200213199 NA 5.42E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200213199 NA 1.27E-09 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200213199 NA 2.77E-11 mr1352_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200213199 NA 7.93E-06 mr1366_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200213199 NA 1.35E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200213199 NA 2.68E-06 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200213199 NA 5.26E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200213199 NA 3.20E-06 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200213199 NA 1.40E-07 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200213199 NA 1.08E-06 mr1469_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200213199 NA 8.47E-07 mr1555_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200213199 NA 9.66E-17 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200213199 NA 5.39E-07 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200213199 8.36E-07 4.74E-09 mr1790_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200213199 NA 4.95E-08 mr1805_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200213199 NA 7.54E-12 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200213199 NA 4.83E-11 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200213199 NA 9.52E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200213199 NA 8.18E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200213199 NA 5.03E-12 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251