\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0143167776:

Variant ID: vg0143167776 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 43167776
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


CGCTCATTTTTTAAGTTATTGTACCAAATTACACCCACATACCAAGTTGATGCACCATGGATGCAATTTACTCTAAGTATTGATTTTTCTCAACTATCTG[A/T]
CGACTAGTATTATCTTACCCGTATCACGCAATTGCTAAGTTGAGTTACAAAACCGAAACAATTGCAAAGGATTAAAAAAACGAAGTAGTATAACAAAACT

Reverse complement sequence

AGTTTTGTTATACTACTTCGTTTTTTTAATCCTTTGCAATTGTTTCGGTTTTGTAACTCAACTTAGCAATTGCGTGATACGGGTAAGATAATACTAGTCG[T/A]
CAGATAGTTGAGAAAAATCAATACTTAGAGTAAATTGCATCCATGGTGCATCAACTTGGTATGTGGGTGTAATTTGGTACAATAACTTAAAAAATGAGCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.00% 47.00% 0.04% 0.00% NA
All Indica  2759 80.20% 19.70% 0.07% 0.00% NA
All Japonica  1512 1.80% 98.20% 0.00% 0.00% NA
Aus  269 85.90% 14.10% 0.00% 0.00% NA
Indica I  595 85.20% 14.80% 0.00% 0.00% NA
Indica II  465 95.50% 4.30% 0.22% 0.00% NA
Indica III  913 76.00% 24.00% 0.00% 0.00% NA
Indica Intermediate  786 72.30% 27.60% 0.13% 0.00% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 3.60% 96.40% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 34.40% 65.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0143167776 A -> T LOC_Os01g74520.1 upstream_gene_variant ; 4927.0bp to feature; MODIFIER silent_mutation Average:49.674; most accessible tissue: Minghui63 root, score: 81.505 N N N N
vg0143167776 A -> T LOC_Os01g74530.2 upstream_gene_variant ; 789.0bp to feature; MODIFIER silent_mutation Average:49.674; most accessible tissue: Minghui63 root, score: 81.505 N N N N
vg0143167776 A -> T LOC_Os01g74520.2 upstream_gene_variant ; 4927.0bp to feature; MODIFIER silent_mutation Average:49.674; most accessible tissue: Minghui63 root, score: 81.505 N N N N
vg0143167776 A -> T LOC_Os01g74540.1 downstream_gene_variant ; 4318.0bp to feature; MODIFIER silent_mutation Average:49.674; most accessible tissue: Minghui63 root, score: 81.505 N N N N
vg0143167776 A -> T LOC_Os01g74530-LOC_Os01g74540 intergenic_region ; MODIFIER silent_mutation Average:49.674; most accessible tissue: Minghui63 root, score: 81.505 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0143167776 NA 1.32E-09 mr1244 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143167776 5.92E-06 2.27E-22 mr1518 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143167776 NA 6.95E-07 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143167776 NA 1.24E-13 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143167776 NA 2.43E-21 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143167776 NA 1.04E-06 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143167776 NA 4.39E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143167776 NA 3.34E-19 mr1754 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143167776 NA 1.94E-06 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143167776 NA 2.10E-08 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143167776 NA 1.72E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143167776 NA 1.83E-07 mr1244_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143167776 NA 1.35E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143167776 NA 1.07E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143167776 NA 1.16E-09 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143167776 NA 3.63E-22 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251