Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0143167776:

Variant ID: vg0143167776 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 43167776
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

CGCTCATTTTTTAAGTTATTGTACCAAATTACACCCACATACCAAGTTGATGCACCATGGATGCAATTTACTCTAAGTATTGATTTTTCTCAACTATCTG[A/T]
CGACTAGTATTATCTTACCCGTATCACGCAATTGCTAAGTTGAGTTACAAAACCGAAACAATTGCAAAGGATTAAAAAAACGAAGTAGTATAACAAAACT

Reverse complement sequence

AGTTTTGTTATACTACTTCGTTTTTTTAATCCTTTGCAATTGTTTCGGTTTTGTAACTCAACTTAGCAATTGCGTGATACGGGTAAGATAATACTAGTCG[T/A]
CAGATAGTTGAGAAAAATCAATACTTAGAGTAAATTGCATCCATGGTGCATCAACTTGGTATGTGGGTGTAATTTGGTACAATAACTTAAAAAATGAGCG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.00%	47.00%	0.04%	0.00%	NA
All Indica	2759	80.20%	19.70%	0.07%	0.00%	NA
All Japonica	1512	1.80%	98.20%	0.00%	0.00%	NA
Aus	269	85.90%	14.10%	0.00%	0.00%	NA
Indica I	595	85.20%	14.80%	0.00%	0.00%	NA
Indica II	465	95.50%	4.30%	0.22%	0.00%	NA
Indica III	913	76.00%	24.00%	0.00%	0.00%	NA
Indica Intermediate	786	72.30%	27.60%	0.13%	0.00%	NA
Temperate Japonica	767	0.90%	99.10%	0.00%	0.00%	NA
Tropical Japonica	504	3.60%	96.40%	0.00%	0.00%	NA
Japonica Intermediate	241	0.80%	99.20%	0.00%	0.00%	NA
VI/Aromatic	96	3.10%	96.90%	0.00%	0.00%	NA
Intermediate	90	34.40%	65.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0143167776	A -> T	LOC_Os01g74520.1	upstream_gene_variant ; 4927.0bp to feature; MODIFIER	silent_mutation	Average:49.674; most accessible tissue: Minghui63 root, score: 81.505	N	N	N	N
vg0143167776	A -> T	LOC_Os01g74530.2	upstream_gene_variant ; 789.0bp to feature; MODIFIER	silent_mutation	Average:49.674; most accessible tissue: Minghui63 root, score: 81.505	N	N	N	N
vg0143167776	A -> T	LOC_Os01g74520.2	upstream_gene_variant ; 4927.0bp to feature; MODIFIER	silent_mutation	Average:49.674; most accessible tissue: Minghui63 root, score: 81.505	N	N	N	N
vg0143167776	A -> T	LOC_Os01g74540.1	downstream_gene_variant ; 4318.0bp to feature; MODIFIER	silent_mutation	Average:49.674; most accessible tissue: Minghui63 root, score: 81.505	N	N	N	N
vg0143167776	A -> T	LOC_Os01g74530-LOC_Os01g74540	intergenic_region ; MODIFIER	silent_mutation	Average:49.674; most accessible tissue: Minghui63 root, score: 81.505	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0143167776	NA	1.32E-09	mr1244	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143167776	5.92E-06	2.27E-22	mr1518	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143167776	NA	6.95E-07	mr1518	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143167776	NA	1.24E-13	mr1653	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143167776	NA	2.43E-21	mr1676	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143167776	NA	1.04E-06	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143167776	NA	4.39E-11	mr1713	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143167776	NA	3.34E-19	mr1754	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143167776	NA	1.94E-06	mr1850	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143167776	NA	2.10E-08	mr1004_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143167776	NA	1.72E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143167776	NA	1.83E-07	mr1244_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143167776	NA	1.35E-06	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143167776	NA	1.07E-13	mr1521_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143167776	NA	1.16E-09	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143167776	NA	3.63E-22	mr1676_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251