\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0143123163:

Variant ID: vg0143123163 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 43123163
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.89, A: 0.11, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


ATCAAAAAAATGAACATAAGCATATAAGAAAGCCATAGAATTGTATCTTGGAAGGCATATGGGTGAAAAAGACTCCGAAGTCCTGCATTAAAGAAAATGT[A/T]
GTAAGAACGTCTCAAAGTAAAGATTACCATTTCAGAGTGTGTGTCGTGATGATTACCTAAAAGATTCAGAGGACAATATGAAATTTGAAAGTAGAAAAAT

Reverse complement sequence

ATTTTTCTACTTTCAAATTTCATATTGTCCTCTGAATCTTTTAGGTAATCATCACGACACACACTCTGAAATGGTAATCTTTACTTTGAGACGTTCTTAC[T/A]
ACATTTTCTTTAATGCAGGACTTCGGAGTCTTTTTCACCCATATGCCTTCCAAGATACAATTCTATGGCTTTCTTATATGCTTATGTTCATTTTTTTGAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.80% 41.10% 0.08% 0.02% NA
All Indica  2759 82.50% 17.50% 0.04% 0.04% NA
All Japonica  1512 9.80% 90.10% 0.13% 0.00% NA
Aus  269 86.60% 13.40% 0.00% 0.00% NA
Indica I  595 85.00% 15.00% 0.00% 0.00% NA
Indica II  465 96.10% 3.40% 0.22% 0.22% NA
Indica III  913 81.70% 18.30% 0.00% 0.00% NA
Indica Intermediate  786 73.30% 26.70% 0.00% 0.00% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 26.00% 74.00% 0.00% 0.00% NA
Japonica Intermediate  241 4.10% 95.00% 0.83% 0.00% NA
VI/Aromatic  96 76.00% 24.00% 0.00% 0.00% NA
Intermediate  90 54.40% 44.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0143123163 A -> T LOC_Os01g74460.1 3_prime_UTR_variant ; 53.0bp to feature; MODIFIER silent_mutation Average:40.192; most accessible tissue: Minghui63 flag leaf, score: 50.629 N N N N
vg0143123163 A -> T LOC_Os01g74460.2 3_prime_UTR_variant ; 53.0bp to feature; MODIFIER silent_mutation Average:40.192; most accessible tissue: Minghui63 flag leaf, score: 50.629 N N N N
vg0143123163 A -> T LOC_Os01g74470.1 downstream_gene_variant ; 2800.0bp to feature; MODIFIER silent_mutation Average:40.192; most accessible tissue: Minghui63 flag leaf, score: 50.629 N N N N
vg0143123163 A -> DEL N N silent_mutation Average:40.192; most accessible tissue: Minghui63 flag leaf, score: 50.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0143123163 NA 9.12E-08 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143123163 NA 7.30E-07 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143123163 NA 8.41E-06 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143123163 NA 1.43E-14 mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143123163 NA 1.03E-08 mr1244 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143123163 NA 1.10E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143123163 3.26E-06 1.63E-08 mr1448 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143123163 NA 7.10E-19 mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143123163 NA 7.09E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143123163 NA 4.10E-06 mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143123163 NA 1.44E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143123163 NA 7.23E-07 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143123163 NA 1.66E-08 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143123163 NA 4.70E-06 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143123163 NA 5.10E-08 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143123163 NA 1.92E-09 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143123163 NA 8.66E-20 mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143123163 NA 3.34E-07 mr1244_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143123163 NA 3.90E-16 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143123163 NA 6.88E-06 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143123163 NA 3.85E-06 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143123163 NA 9.29E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251