\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0143071069:

Variant ID: vg0143071069 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 43071069
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.80, G: 0.21, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TGGGGGTGACCATCGCCCATGGCGGAGTGCTGCCCAACATCAACCTGGTGCTCCTCCCAAAGAGGGCCGCGGAGAAGGCCAACAAGGAGGCCAAGTCGCC[A/G]
AAGAAGAACCCCGCCACCGCCAAGTCCCCCAAGAAGGCCGTCGCCGCCGCCGAGTAGAGTAGAGTAGAGTAGAGTAGAGTAGAGTCTGAATCGGGTTTCT

Reverse complement sequence

AGAAACCCGATTCAGACTCTACTCTACTCTACTCTACTCTACTCTACTCGGCGGCGGCGACGGCCTTCTTGGGGGACTTGGCGGTGGCGGGGTTCTTCTT[T/C]
GGCGACTTGGCCTCCTTGTTGGCCTTCTCCGCGGCCCTCTTTGGGAGGAGCACCAGGTTGATGTTGGGCAGCACTCCGCCATGGGCGATGGTCACCCCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.20% 37.70% 0.04% 0.00% NA
All Indica  2759 90.00% 9.90% 0.04% 0.00% NA
All Japonica  1512 9.90% 90.10% 0.00% 0.00% NA
Aus  269 68.80% 31.20% 0.00% 0.00% NA
Indica I  595 94.10% 5.90% 0.00% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 86.30% 13.70% 0.00% 0.00% NA
Indica Intermediate  786 86.50% 13.40% 0.13% 0.00% NA
Temperate Japonica  767 0.80% 99.20% 0.00% 0.00% NA
Tropical Japonica  504 26.00% 74.00% 0.00% 0.00% NA
Japonica Intermediate  241 5.00% 95.00% 0.00% 0.00% NA
VI/Aromatic  96 76.00% 24.00% 0.00% 0.00% NA
Intermediate  90 55.60% 43.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0143071069 A -> G LOC_Os01g74330.1 upstream_gene_variant ; 903.0bp to feature; MODIFIER silent_mutation Average:87.441; most accessible tissue: Zhenshan97 panicle, score: 95.903 N N N N
vg0143071069 A -> G LOC_Os01g74340.1 upstream_gene_variant ; 447.0bp to feature; MODIFIER silent_mutation Average:87.441; most accessible tissue: Zhenshan97 panicle, score: 95.903 N N N N
vg0143071069 A -> G LOC_Os01g74350.1 downstream_gene_variant ; 1679.0bp to feature; MODIFIER silent_mutation Average:87.441; most accessible tissue: Zhenshan97 panicle, score: 95.903 N N N N
vg0143071069 A -> G LOC_Os01g74330-LOC_Os01g74340 intergenic_region ; MODIFIER silent_mutation Average:87.441; most accessible tissue: Zhenshan97 panicle, score: 95.903 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0143071069 A G 0.04 0.03 0.03 0.01 0.03 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0143071069 NA 2.46E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143071069 NA 8.47E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143071069 NA 1.15E-06 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143071069 NA 2.60E-08 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143071069 1.62E-07 1.62E-07 mr1848 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143071069 NA 3.02E-20 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143071069 NA 2.55E-19 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143071069 NA 1.67E-07 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143071069 NA 4.06E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143071069 NA 4.41E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251