Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142965130:

Variant ID: vg0142965130 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 42965130
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.57, C: 0.43, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

GTCTCTTTCTATAATATGCCGGTGACTTTACAATTATTCTGCAATACGCCATTGGACAGGACATTTTTTTAAAAAAATACCCTAAATACCCTTAGACATA[T/C]
AAGATTAACAATTGATTTATCTCATCAGAATATTCAAAAAAAATATGTGGCCTCCTTACACAATATGGAAGTTTGTATACAGGTTTCATGTTTTTTCTGG

Reverse complement sequence

CCAGAAAAAACATGAAACCTGTATACAAACTTCCATATTGTGTAAGGAGGCCACATATTTTTTTTGAATATTCTGATGAGATAAATCAATTGTTAATCTT[A/G]
TATGTCTAAGGGTATTTAGGGTATTTTTTTAAAAAAATGTCCTGTCCAATGGCGTATTGCAGAATAATTGTAAAGTCACCGGCATATTATAGAAAGAGAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.40%	36.40%	0.19%	0.04%	NA
All Indica	2759	93.80%	6.10%	0.07%	0.07%	NA
All Japonica	1512	9.10%	90.60%	0.33%	0.00%	NA
Aus	269	53.50%	46.50%	0.00%	0.00%	NA
Indica I	595	95.00%	5.00%	0.00%	0.00%	NA
Indica II	465	95.70%	3.90%	0.00%	0.43%	NA
Indica III	913	98.70%	1.30%	0.00%	0.00%	NA
Indica Intermediate	786	86.00%	13.70%	0.25%	0.00%	NA
Temperate Japonica	767	0.70%	99.20%	0.13%	0.00%	NA
Tropical Japonica	504	23.80%	75.80%	0.40%	0.00%	NA
Japonica Intermediate	241	5.00%	94.20%	0.83%	0.00%	NA
VI/Aromatic	96	78.10%	21.90%	0.00%	0.00%	NA
Intermediate	90	56.70%	41.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0142965130	T -> DEL	N	N	silent_mutation	Average:33.284; most accessible tissue: Zhenshan97 young leaf, score: 47.311	N	N	N	N
vg0142965130	T -> C	LOC_Os01g74160.1	downstream_gene_variant ; 140.0bp to feature; MODIFIER	silent_mutation	Average:33.284; most accessible tissue: Zhenshan97 young leaf, score: 47.311	N	N	N	N
vg0142965130	T -> C	LOC_Os01g74170.1	downstream_gene_variant ; 1920.0bp to feature; MODIFIER	silent_mutation	Average:33.284; most accessible tissue: Zhenshan97 young leaf, score: 47.311	N	N	N	N
vg0142965130	T -> C	LOC_Os01g74160-LOC_Os01g74170	intergenic_region ; MODIFIER	silent_mutation	Average:33.284; most accessible tissue: Zhenshan97 young leaf, score: 47.311	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0142965130	NA	2.88E-06	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142965130	NA	6.32E-08	mr1448	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142965130	NA	2.94E-07	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142965130	NA	1.43E-19	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142965130	NA	9.54E-09	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142965130	NA	1.78E-08	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142965130	NA	1.36E-06	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142965130	NA	3.05E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142965130	NA	1.84E-06	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142965130	NA	5.33E-12	mr1938	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142965130	1.87E-06	1.87E-06	mr1978	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142965130	NA	7.70E-07	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142965130	NA	2.00E-12	mr1666_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142965130	NA	7.74E-10	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142965130	NA	9.35E-10	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251